Detail information of JCDBG00001

JCDBG00001
ID
JCDBG00001
Name
trnH-GUG
Type
tRNA
Scaffold
NC_012224.1
Start
70
End
144
Strand
-
Link
Genbank id:7636412
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGGGTTCAATTCCCGTCGTTCGC
Gene structure

JCDB Genes gff download

JCDBG00001 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00001
ID
JCDBR00001
Name
JCDBR00001
Type
Scaffold
NC_012224.1
Start
70
End
144
Strand
-
Exon
70-144
Sequence
GGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGGGTTCAATTCCCGTCGTTCGC
Product
tRNA-His
Source
RefSeq
Link: