Detail information of JCDBG00003

JCDBG00003
ID
JCDBG00003
Name
trnK-UUU
Type
tRNA
Scaffold
NC_012224.1
Start
1841
End
4606
Strand
-
Link
Genbank id:7636413
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGGGGGGTTGCTAACTCAACGGTAGAGTACTCGGCTTTTAAGTGCGGCTAACTTCTTTTACACGTTTGTATGAAGAAAGG GATTCGTCCATACCGTCGGTATAGTTTGTAAGACCACGACTGATCCTGAAAGGAATGAATGGAAAAAACAGCATGTCGTA TCAATGGAGAATTCTGCGAATATTTCATTTTTGCCGGATCGGTCCAACCTTATTTGAATTCTTGATTTGATGCGGAACAT AAAAAAATGAATTCAAAGTTCGGTCGAGTTAATAAATGGATAGAGTCCTACGATTCCAATTATAGGGAAACAAAAAAGCA ACGAGCTTACGTTCTTAATTTGAACGATTATCCGATCTAATTAGACGTTAAAAATAAATTAGTACCTAATGCGGGAAAGG TTTCTCTATAAGCAGATTTTCTATTTTCTTTTAATGAGTCCTAACTATTAGCTATTCTCCACTATGAAGGGGAGACGAAT GTGTAGAAGAAAGAGTATATTGATAAAGAGATTTTTTCCAAAATCAAAAGAGCGATTGACTTGAAAAAATAAAGGATTTC TAATCATCTTTTTATCCTATCCTATAATGCACATAAACAAATTAGATGGAAAAAAGAAGAGGGTGGGGAGCCCGTTAATG ATAATGAGTTTATCTATTTCCGAGGTATCTACTCTTTGCTTATTATACTACATTTGTTTTTACTGTATCGCACTATGTAT CATTCACTATGTATCATTTTATAACCAACTCAATAAAAATCCTCTATCCTTGCTTCAATCAAATCTAATACATGTGGAAA TATCAAAGATATTTAGAACTAGATGGATCTCGAAAAAATGACCTCCTATACCCATTTATCTTTCGGGAGTATATTTATAT ATTTGCTCATGATCATAGTTTAAATAGATCGATTTTGTTGGAAAATGTAGGTTATGACAATAAATCTAGTTTCTTAATTG TAAAACGTTTAATTACTCGAATGTATCAACAGAATCGTTTGGTTTTTTTTTCTTTTTCTGCTAATGATTCTAACCAAAAT TCATTTTTTAAGTACAACAAGAATTTGTATTATCAAATGATATCAGAGAGCTTTGCAGTTATTGTGGAAATTCCATTTTC TCTACGGTTAGTATCTTCTTTAGAAAGGTCGGAGATAGTTAAATCTCATAAATTACGATCAATTCATTCAATATTTCCTT TTTTAGAGGACAAATTTCCACATTTAATTTATGTGTCAGATGTATTAATACCTTACCCCATCCATATAGAAAAATTAGTC CAAACCCTTCGCTATTGGATGAAAGATCCCTCTTCTTTGCATTTATTACGACTCTTTCTTCATGAATATTGGAATAGGAA CAGTCTTATTATTCAAAAGGGATCTATTTCTATTTTTACAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTCTC ATGTATATGAATACGAATCAATCCTCTTTTTTCTTCGTAACCAATCCTTTCATTTACGATCAACATTTTCTCGAGTCCTT CTTGAACGAATTTATTTCTATGGAAAAATAGAACATTTTGCAGAAGTCTTTGCTAATGATTTTCAGACTATCCTATGGTT GGTCAAGTATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGATGGGCCTCTTCTGATGA AAAAATGGAAATATTACCTTGTCAATTTATGTCAATGTCATTTTTATGTGTGGTTTCAACCAGAAAAGATCTATATAAAT TCATTATCCAAGCATTCTCTCAACCTTTTGGGCTATCTTTCAAATGTAAAATTAAATCCTTCGGTCGTACGAAGTCAAAT GCTAGAAAATTCATTTCTAATAGATAAAGATAATACTATGAAGAAACTCGATACAATAGTTCCAATTATTCCTTTGATTG GATCATTGTCAAAAACGAAATTTTGTAAGGCAGTAGGACATCCCATTAGTAAACCGGTCCGGACTGATTCATCGGATTCT GATATTATCGACCGATTTGTGTGTATATGCAGAAATCTTTCTCATTATTATAGTGGATCTTCAATAAAAAAGAGTTTGTA TCGAGTAAAATATATACTTCGACTTTCTTGTGTTAAAACTTTGATTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGA AAAGATTGGGTTCGGAATTATTAGAAGAATTTTTTACAGAAGAAGAACAAACTCTTTCTTTGATCTTCCCGAGAGTTTCC TCTATTTCGCGCAGGTTATATAGGGGGCGGGTTTGGTATTTGGATATTATTTCTATCAATGATTTGGCCAATCATGAATA ATTGGTTATGAAATCGAAATTTTCTCTAAATAACTAAAAAATAAATAATATAATGATAATGAGATATATAATATAATGAA ATATATAATAAGAAATATTATATAAAGAAATATTATATAATTAATAAGAAATATTATATATTTATTATATATTAAAAAAT ATAATGAAATAGAATGAAGGGATAACAAAAAATTCATTCAGTTCTATTATGAATATGAAATATGAAATGCTCATACAGTA TACGAGTAAGGATTGAGCAACTGAGTATTCAACTTCCTTATAGGTTTCGTCTAGGAAGGGAACTGGGTTTTAGATGTATA CATAGGGAAAGCCGTGTGCAATGAAAACGCAAGCACGGCTTGGAGAGGGATTTTTTACCTATTTTTTAACAAGGAAAATT TCTACTCTATCCGACTAGTTCCGGGTTCGAGTCCCGGGTAACCCAT
Gene structure

JCDB Genes gff download

JCDBG00003 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00003's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00003JCDBG25274co-exp0.898339
JCDBG00003JCDBG00989co-exp0.823533
JCDBG00003JCDBG00044co-exp0.808955
JCDBG00003JCDBG24818co-exp0.736289
JCDBG00003JCDBG00851co-exp0.713392
JCDBG00003JCDBG18679co-exp0.671498
JCDBG00003JCDBG00039co-exp0.663478
JCDBG00003JCDBG04201co-exp0.655206
JCDBG25274JCDBG00989co-exp0.736685
JCDBG25274JCDBG00044co-exp0.72347
JCDBG25274JCDBG24818co-exp0.659395
JCDBG25274JCDBG00851co-exp0.635247
JCDBG00989JCDBG00044co-exp0.660031
JCDBG00989JCDBG24818co-exp0.610394
JCDBG00989JCDBG04201co-exp0.716892
JCDBG00044JCDBG18679co-exp0.736685
JCDBG00044JCDBG00039co-exp0.91683
JCDBG24818JCDBG04201co-exp0.663513
JCDBG00851JCDBG18679co-exp0.623803
JCDBG00851JCDBG00039co-exp0.629475
JCDBG18679JCDBG00039co-exp0.804922
PPI network
node1node2type
JCDBR00003
ID
JCDBR00003
Name
JCDBR00003
Type
Scaffold
NC_012224.1
Start
1841
End
4606
Strand
-
Exon
1841-1877,4567-4606
Sequence
GGGGGGGTTGCTAACTCAACGGTAGAGTACTCGGCTTTTAAGTGCGGCTAACTTCTTTTACACGTTTGTATGAAGAAAGG GATTCGTCCATACCGTCGGTATAGTTTGTAAGACCACGACTGATCCTGAAAGGAATGAATGGAAAAAACAGCATGTCGTA TCAATGGAGAATTCTGCGAATATTTCATTTTTGCCGGATCGGTCCAACCTTATTTGAATTCTTGATTTGATGCGGAACAT AAAAAAATGAATTCAAAGTTCGGTCGAGTTAATAAATGGATAGAGTCCTACGATTCCAATTATAGGGAAACAAAAAAGCA ACGAGCTTACGTTCTTAATTTGAACGATTATCCGATCTAATTAGACGTTAAAAATAAATTAGTACCTAATGCGGGAAAGG TTTCTCTATAAGCAGATTTTCTATTTTCTTTTAATGAGTCCTAACTATTAGCTATTCTCCACTATGAAGGGGAGACGAAT GTGTAGAAGAAAGAGTATATTGATAAAGAGATTTTTTCCAAAATCAAAAGAGCGATTGACTTGAAAAAATAAAGGATTTC TAATCATCTTTTTATCCTATCCTATAATGCACATAAACAAATTAGATGGAAAAAAGAAGAGGGTGGGGAGCCCGTTAATG ATAATGAGTTTATCTATTTCCGAGGTATCTACTCTTTGCTTATTATACTACATTTGTTTTTACTGTATCGCACTATGTAT CATTCACTATGTATCATTTTATAACCAACTCAATAAAAATCCTCTATCCTTGCTTCAATCAAATCTAATACATGTGGAAA TATCAAAGATATTTAGAACTAGATGGATCTCGAAAAAATGACCTCCTATACCCATTTATCTTTCGGGAGTATATTTATAT ATTTGCTCATGATCATAGTTTAAATAGATCGATTTTGTTGGAAAATGTAGGTTATGACAATAAATCTAGTTTCTTAATTG TAAAACGTTTAATTACTCGAATGTATCAACAGAATCGTTTGGTTTTTTTTTCTTTTTCTGCTAATGATTCTAACCAAAAT TCATTTTTTAAGTACAACAAGAATTTGTATTATCAAATGATATCAGAGAGCTTTGCAGTTATTGTGGAAATTCCATTTTC TCTACGGTTAGTATCTTCTTTAGAAAGGTCGGAGATAGTTAAATCTCATAAATTACGATCAATTCATTCAATATTTCCTT TTTTAGAGGACAAATTTCCACATTTAATTTATGTGTCAGATGTATTAATACCTTACCCCATCCATATAGAAAAATTAGTC CAAACCCTTCGCTATTGGATGAAAGATCCCTCTTCTTTGCATTTATTACGACTCTTTCTTCATGAATATTGGAATAGGAA CAGTCTTATTATTCAAAAGGGATCTATTTCTATTTTTACAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTCTC ATGTATATGAATACGAATCAATCCTCTTTTTTCTTCGTAACCAATCCTTTCATTTACGATCAACATTTTCTCGAGTCCTT CTTGAACGAATTTATTTCTATGGAAAAATAGAACATTTTGCAGAAGTCTTTGCTAATGATTTTCAGACTATCCTATGGTT GGTCAAGTATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAGATGGGCCTCTTCTGATGA AAAAATGGAAATATTACCTTGTCAATTTATGTCAATGTCATTTTTATGTGTGGTTTCAACCAGAAAAGATCTATATAAAT TCATTATCCAAGCATTCTCTCAACCTTTTGGGCTATCTTTCAAATGTAAAATTAAATCCTTCGGTCGTACGAAGTCAAAT GCTAGAAAATTCATTTCTAATAGATAAAGATAATACTATGAAGAAACTCGATACAATAGTTCCAATTATTCCTTTGATTG GATCATTGTCAAAAACGAAATTTTGTAAGGCAGTAGGACATCCCATTAGTAAACCGGTCCGGACTGATTCATCGGATTCT GATATTATCGACCGATTTGTGTGTATATGCAGAAATCTTTCTCATTATTATAGTGGATCTTCAATAAAAAAGAGTTTGTA TCGAGTAAAATATATACTTCGACTTTCTTGTGTTAAAACTTTGATTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGA AAAGATTGGGTTCGGAATTATTAGAAGAATTTTTTACAGAAGAAGAACAAACTCTTTCTTTGATCTTCCCGAGAGTTTCC TCTATTTCGCGCAGGTTATATAGGGGGCGGGTTTGGTATTTGGATATTATTTCTATCAATGATTTGGCCAATCATGAATA ATTGGTTATGAAATCGAAATTTTCTCTAAATAACTAAAAAATAAATAATATAATGATAATGAGATATATAATATAATGAA ATATATAATAAGAAATATTATATAAAGAAATATTATATAATTAATAAGAAATATTATATATTTATTATATATTAAAAAAT ATAATGAAATAGAATGAAGGGATAACAAAAAATTCATTCAGTTCTATTATGAATATGAAATATGAAATGCTCATACAGTA TACGAGTAAGGATTGAGCAACTGAGTATTCAACTTCCTTATAGGTTTCGTCTAGGAAGGGAACTGGGTTTTAGATGTATA CATAGGGAAAGCCGTGTGCAATGAAAACGCAAGCACGGCTTGGAGAGGGATTTTTTACCTATTTTTTAACAAGGAAAATT TCTACTCTATCCGACTAGTTCCGGGTTCGAGTCCCGGGTAACCCAT
Product
tRNA-Lys
Source
RefSeq
Link: