Detail information of JCDBG00005

JCDBG00005
ID
JCDBG00005
Name
trnQ-UUG
Type
tRNA
Scaffold
NC_012224.1
Start
6266
End
6337
Strand
-
Link
Genbank id:7636414
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
ATGGGGCGTGGCCAAGCGGTAAGGCATCGGGTTTTGGTCCCGCTATTCGGAGGTTCGAATCCTTCCGTCCCA
Gene structure

JCDB Genes gff download

JCDBG00005 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00005
ID
JCDBR00005
Name
JCDBR00005
Type
Scaffold
NC_012224.1
Start
6266
End
6337
Strand
-
Exon
6266-6337
Sequence
ATGGGGCGTGGCCAAGCGGTAAGGCATCGGGTTTTGGTCCCGCTATTCGGAGGTTCGAATCCTTCCGTCCCA
Product
tRNA-Gln
Source
RefSeq
Link: