Detail information of JCDBG00008

JCDBG00008
ID
JCDBG00008
Name
trnS-GCU
Type
tRNA
Scaffold
NC_012224.1
Start
7464
End
7551
Strand
-
Link
Genbank id:7636415
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGGAGAGATGGCTGAGTGGACTAAAGCGTCGGATTGCTAATCCGTTGTACGAGTTATTCGTACCGAGGGTTCGAATCCCT CTCTTTCC
Gene structure

JCDB Genes gff download

JCDBG00008 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00008's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00008JCDBG01399co-exp1
JCDBG00008JCDBG15096co-exp0.710229
JCDBG00008JCDBG00322co-exp0.697658
JCDBG01399JCDBG15096co-exp0.710229
JCDBG01399JCDBG00322co-exp0.697658
PPI network
node1node2type
JCDBR00008
ID
JCDBR00008
Name
JCDBR00008
Type
Scaffold
NC_012224.1
Start
7464
End
7551
Strand
-
Exon
7464-7551
Sequence
GGGAGAGATGGCTGAGTGGACTAAAGCGTCGGATTGCTAATCCGTTGTACGAGTTATTCGTACCGAGGGTTCGAATCCCT CTCTTTCC
Product
tRNA-Ser
Source
RefSeq
Link: