Detail information of JCDBG00009

JCDBG00009
ID
JCDBG00009
Name
trnG-GCC
Type
tRNA
Scaffold
NC_012224.1
Start
8891
End
9675
Strand
+
Link
Genbank id:7636416
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
CGGATATAGTTTAGTGGTAAAAGTGTGATTCGGTTTATTAATTATTAATTCTAATAGTCTAATAGTTAAGGGATCCCTCG GTTCATATTCCGATGAAAAACTTTATTTCTTAAAAAGATTTAATCCTTTACCTCTCAATGAAAAATTCGAGGAAGAATAT ACATTCTCGTGATTTGTATCCAAGAGTCAATTAGAAATTGAGAAATTGGATTATGAAATTACGAAACATAATTTTTTTTA TTTGATCAATACTTTAAAATGAATGAGTATGAGTAAAGGATCTATGGAAAAAGACAGAAAAGTGTATTTCTAATCGCAAC TAAATCTTCAATTTTTCTTTGTTTTGTTTTGTATAGTCGAGATTGAAGCAAAATAAGTATTTAAAGGATGTCTTTAGTTT ACTATAAGACATCGACTTCTTTTTTTAGCTCGGTGGAAACAAAATGCTTTTCCTAAGGATTTTTTCAAATAGAAATAGAG AACGAAGTAACTAGAAAGATTATTAAAATCCCACTCATCTAGAGGGATCATCTAGAAAGCGCCTTGTTTTGAATACATTA AGACAGAAAAGCTGACATAGATGTTATGGGTCAATTTTTTTTTCGCTCGCCCCTTATAGCTGGATAGCTGGAAATTTTCC AGATTCCATAAAGGAGCCGAATGAAACCAAAGTTTCATGTTCGGTTTTGAATTAGAGACGTTAAATTAAAGATGATGAAT CAACGTCGACTATAACCCCTAGCCTTCCAAGCTAGCGATGCGGGTTCGATTCCCGCTATCCGCTT
Gene structure

JCDB Genes gff download

JCDBG00009 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00009
ID
JCDBR00009
Name
JCDBR00009
Type
Scaffold
NC_012224.1
Start
8891
End
9675
Strand
+
Exon
8891-8913,9630-9675
Sequence
CGGATATAGTTTAGTGGTAAAAGTGTGATTCGGTTTATTAATTATTAATTCTAATAGTCTAATAGTTAAGGGATCCCTCG GTTCATATTCCGATGAAAAACTTTATTTCTTAAAAAGATTTAATCCTTTACCTCTCAATGAAAAATTCGAGGAAGAATAT ACATTCTCGTGATTTGTATCCAAGAGTCAATTAGAAATTGAGAAATTGGATTATGAAATTACGAAACATAATTTTTTTTA TTTGATCAATACTTTAAAATGAATGAGTATGAGTAAAGGATCTATGGAAAAAGACAGAAAAGTGTATTTCTAATCGCAAC TAAATCTTCAATTTTTCTTTGTTTTGTTTTGTATAGTCGAGATTGAAGCAAAATAAGTATTTAAAGGATGTCTTTAGTTT ACTATAAGACATCGACTTCTTTTTTTAGCTCGGTGGAAACAAAATGCTTTTCCTAAGGATTTTTTCAAATAGAAATAGAG AACGAAGTAACTAGAAAGATTATTAAAATCCCACTCATCTAGAGGGATCATCTAGAAAGCGCCTTGTTTTGAATACATTA AGACAGAAAAGCTGACATAGATGTTATGGGTCAATTTTTTTTTCGCTCGCCCCTTATAGCTGGATAGCTGGAAATTTTCC AGATTCCATAAAGGAGCCGAATGAAACCAAAGTTTCATGTTCGGTTTTGAATTAGAGACGTTAAATTAAAGATGATGAAT CAACGTCGACTATAACCCCTAGCCTTCCAAGCTAGCGATGCGGGTTCGATTCCCGCTATCCGCTT
Product
tRNA-Gly
Source
RefSeq
Link: