Detail information of JCDBG00010

JCDBG00010
ID
JCDBG00010
Name
trnR-UCU
Type
tRNA
Scaffold
NC_012224.1
Start
10487
End
10558
Strand
+
Link
Genbank id:7636417
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
CGTCCATTGTCTAATGGATAGGACAGAGGTCTTCTAAACCTTTGGTATAGGTTCAAATCCTATTGGACGCAA
Gene structure

JCDB Genes gff download

JCDBG00010 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00010's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00010JCDBG00068co-exp0.778257
JCDBG00010JCDBG00021co-exp0.771957
JCDBG00010JCDBG00028co-exp0.771697
JCDBG00010JCDBG00040co-exp0.755398
JCDBG00010JCDBG00011co-exp0.71933
JCDBG00010JCDBG00031co-exp0.718689
JCDBG00010JCDBG00075co-exp0.713186
JCDBG00010JCDBG00050co-exp0.711709
JCDBG00010JCDBG18716co-exp0.710628
JCDBG00010JCDBG00069co-exp0.709757
JCDBG00068JCDBG00021co-exp0.790381
JCDBG00068JCDBG00028co-exp0.845636
JCDBG00068JCDBG00040co-exp0.775985
JCDBG00068JCDBG00011co-exp0.750786
JCDBG00068JCDBG00031co-exp0.735015
JCDBG00068JCDBG00075co-exp0.7699
JCDBG00068JCDBG00050co-exp0.789722
JCDBG00068JCDBG18716co-exp0.727494
JCDBG00068JCDBG00069co-exp0.722984
JCDBG00021JCDBG00028co-exp0.793051
JCDBG00021JCDBG00040co-exp0.761717
JCDBG00021JCDBG00011co-exp0.86141
JCDBG00021JCDBG00031co-exp0.712507
JCDBG00021JCDBG00075co-exp0.843724
JCDBG00021JCDBG00050co-exp0.805672
JCDBG00021JCDBG18716co-exp0.787064
JCDBG00021JCDBG00069co-exp0.819065
JCDBG00028JCDBG00040co-exp0.863392
JCDBG00028JCDBG00011co-exp0.676106
JCDBG00028JCDBG00031co-exp0.802201
JCDBG00028JCDBG00075co-exp0.851903
JCDBG00028JCDBG00050co-exp0.913276
JCDBG00028JCDBG18716co-exp0.847572
JCDBG00028JCDBG00069co-exp0.804045
JCDBG00040JCDBG00011co-exp0.645133
JCDBG00040JCDBG00031co-exp0.851424
JCDBG00040JCDBG00075co-exp0.856433
JCDBG00040JCDBG00050co-exp0.85779
JCDBG00040JCDBG18716co-exp0.831643
JCDBG00040JCDBG00069co-exp0.781837
JCDBG00011JCDBG00031co-exp0.636916
JCDBG00011JCDBG00075co-exp0.725212
JCDBG00011JCDBG00050co-exp0.653956
JCDBG00011JCDBG18716co-exp0.642245
JCDBG00011JCDBG00069co-exp0.75584
JCDBG00031JCDBG00075co-exp0.812056
JCDBG00031JCDBG00050co-exp0.81397
JCDBG00031JCDBG18716co-exp0.76006
JCDBG00031JCDBG00069co-exp0.745999
JCDBG00075JCDBG00050co-exp0.919816
JCDBG00075JCDBG18716co-exp0.940498
JCDBG00075JCDBG00069co-exp0.910429
JCDBG00050JCDBG18716co-exp0.899046
JCDBG00050JCDBG00069co-exp0.883856
JCDBG18716JCDBG00069co-exp0.874716
PPI network
node1node2type
JCDBR00010
ID
JCDBR00010
Name
JCDBR00010
Type
Scaffold
NC_012224.1
Start
10487
End
10558
Strand
+
Exon
10487-10558
Sequence
CGTCCATTGTCTAATGGATAGGACAGAGGTCTTCTAAACCTTTGGTATAGGTTCAAATCCTATTGGACGCAA
Product
tRNA-Arg
Source
RefSeq
Link: