Detail information of JCDBG00019

JCDBG00019
ID
JCDBG00019
Name
trnC-GCA
Type
tRNA
Scaffold
NC_012224.1
Start
29741
End
29821
Strand
+
Link
Genbank id:7636418
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GCGGCATGGCCGAGCGGTAAGGCGGGGGACTGCAAATCCTTTTTCCCCAGTTCAAATCCGGGTGTCGCCTGATCAACAAA A
Gene structure

JCDB Genes gff download

JCDBG00019 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00019's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00019JCDBG00020co-exp0.779609
JCDBG00019JCDBG00029co-exp0.730758
JCDBG00019JCDBG00043co-exp0.729506
JCDBG00019JCDBG00013co-exp0.725026
JCDBG00019JCDBG00064co-exp0.707567
JCDBG00019JCDBG00014co-exp0.699439
JCDBG00019JCDBG00015co-exp0.689593
JCDBG00019JCDBG00103co-exp0.687426
JCDBG00019JCDBG00074co-exp0.675687
JCDBG00019JCDBG00076co-exp0.667617
JCDBG00020JCDBG00029co-exp0.868454
JCDBG00020JCDBG00043co-exp0.888094
JCDBG00020JCDBG00013co-exp0.882966
JCDBG00020JCDBG00064co-exp0.899486
JCDBG00020JCDBG00014co-exp0.710887
JCDBG00020JCDBG00015co-exp0.679902
JCDBG00020JCDBG00103co-exp0.756766
JCDBG00020JCDBG00076co-exp0.63442
JCDBG00029JCDBG00043co-exp0.950823
JCDBG00029JCDBG00013co-exp0.954387
JCDBG00029JCDBG00064co-exp0.87883
JCDBG00029JCDBG00014co-exp0.879308
JCDBG00029JCDBG00015co-exp0.810684
JCDBG00029JCDBG00103co-exp0.772204
JCDBG00029JCDBG00074co-exp0.721363
JCDBG00029JCDBG00076co-exp0.780435
JCDBG00043JCDBG00013co-exp0.958265
JCDBG00043JCDBG00064co-exp0.912455
JCDBG00043JCDBG00014co-exp0.885746
JCDBG00043JCDBG00015co-exp0.838211
JCDBG00043JCDBG00103co-exp0.825906
JCDBG00043JCDBG00074co-exp0.72181
JCDBG00043JCDBG00076co-exp0.777139
JCDBG00013JCDBG00064co-exp0.907456
JCDBG00013JCDBG00014co-exp0.863631
JCDBG00013JCDBG00015co-exp0.801903
JCDBG00013JCDBG00103co-exp0.758222
JCDBG00013JCDBG00074co-exp0.710655
JCDBG00013JCDBG00076co-exp0.754789
JCDBG00064JCDBG00014co-exp0.756636
JCDBG00064JCDBG00015co-exp0.698302
JCDBG00064JCDBG00103co-exp0.789889
JCDBG00064JCDBG00074co-exp0.632604
JCDBG00064JCDBG00076co-exp0.667081
JCDBG00014JCDBG00015co-exp0.962428
JCDBG00014JCDBG00103co-exp0.803491
JCDBG00014JCDBG00074co-exp0.908064
JCDBG00014JCDBG00076co-exp0.927644
JCDBG00015JCDBG00103co-exp0.826044
JCDBG00015JCDBG00074co-exp0.915663
JCDBG00015JCDBG00076co-exp0.930852
JCDBG00103JCDBG00074co-exp0.74983
JCDBG00103JCDBG00076co-exp0.754901
JCDBG00074JCDBG00076co-exp0.954077
PPI network
node1node2type
JCDBR00019
ID
JCDBR00019
Name
JCDBR00019
Type
Scaffold
NC_012224.1
Start
29741
End
29821
Strand
+
Exon
29741-29821
Sequence
GCGGCATGGCCGAGCGGTAAGGCGGGGGACTGCAAATCCTTTTTCCCCAGTTCAAATCCGGGTGTCGCCTGATCAACAAA A
Product
tRNA-Cys
Source
RefSeq
Link: