Detail information of JCDBG00022

JCDBG00022
ID
JCDBG00022
Name
trnD-GUC
Type
tRNA
Scaffold
NC_012224.1
Start
33597
End
33669
Strand
-
Link
Genbank id:7636419
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
CGGGATTGTAGTTCAATTGGTCAGAGCACCGCCCTGTCAAGGCGGAAGCTGCGGGTTCGAGCCCCGTCAGTCC
Gene structure

JCDB Genes gff download

JCDBG00022 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00022's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00022JCDBG00028co-exp0.774016
JCDBG00022JCDBG23601co-exp0.769415
JCDBG00022JCDBG16110co-exp0.747647
JCDBG00022JCDBG00065co-exp0.739665
JCDBG00022JCDBG00050co-exp0.732323
JCDBG00022JCDBG00062co-exp0.725369
JCDBG00022JCDBG00030co-exp0.724075
JCDBG00022JCDBG00075co-exp0.72397
JCDBG00022JCDBG10025co-exp0.719585
JCDBG00022JCDBG00012co-exp0.718359
JCDBG00028JCDBG23601co-exp0.869138
JCDBG00028JCDBG16110co-exp0.823764
JCDBG00028JCDBG00065co-exp0.836263
JCDBG00028JCDBG00050co-exp0.913276
JCDBG00028JCDBG00062co-exp0.880102
JCDBG00028JCDBG00030co-exp0.841768
JCDBG00028JCDBG00075co-exp0.851903
JCDBG00028JCDBG10025co-exp0.820388
JCDBG00028JCDBG00012co-exp0.82914
JCDBG23601JCDBG16110co-exp0.94566
JCDBG23601JCDBG00065co-exp0.878862
JCDBG23601JCDBG00050co-exp0.872699
JCDBG23601JCDBG00062co-exp0.866219
JCDBG23601JCDBG00030co-exp0.774751
JCDBG23601JCDBG00075co-exp0.901874
JCDBG23601JCDBG10025co-exp0.94077
JCDBG23601JCDBG00012co-exp0.846475
JCDBG16110JCDBG00065co-exp0.921723
JCDBG16110JCDBG00050co-exp0.86828
JCDBG16110JCDBG00062co-exp0.887449
JCDBG16110JCDBG00030co-exp0.717128
JCDBG16110JCDBG00075co-exp0.905513
JCDBG16110JCDBG10025co-exp0.915336
JCDBG16110JCDBG00012co-exp0.886207
JCDBG00065JCDBG00050co-exp0.904811
JCDBG00065JCDBG00062co-exp0.946062
JCDBG00065JCDBG00030co-exp0.71721
JCDBG00065JCDBG00075co-exp0.920844
JCDBG00065JCDBG10025co-exp0.867616
JCDBG00065JCDBG00012co-exp0.946607
JCDBG00050JCDBG00062co-exp0.929095
JCDBG00050JCDBG00030co-exp0.806102
JCDBG00050JCDBG00075co-exp0.919816
JCDBG00050JCDBG10025co-exp0.866348
JCDBG00050JCDBG00012co-exp0.866965
JCDBG00062JCDBG00030co-exp0.778448
JCDBG00062JCDBG00075co-exp0.905767
JCDBG00062JCDBG10025co-exp0.848252
JCDBG00062JCDBG00012co-exp0.910668
JCDBG00030JCDBG00075co-exp0.774964
JCDBG00030JCDBG10025co-exp0.719649
JCDBG00030JCDBG00012co-exp0.727346
JCDBG00075JCDBG10025co-exp0.937833
JCDBG00075JCDBG00012co-exp0.912519
JCDBG10025JCDBG00012co-exp0.846148
PPI network
node1node2type
JCDBR00022
ID
JCDBR00022
Name
JCDBR00022
Type
Scaffold
NC_012224.1
Start
33597
End
33669
Strand
-
Exon
33597-33669
Sequence
CGGGATTGTAGTTCAATTGGTCAGAGCACCGCCCTGTCAAGGCGGAAGCTGCGGGTTCGAGCCCCGTCAGTCC
Product
tRNA-Asp
Source
RefSeq
Link: