Detail information of JCDBG00023

JCDBG00023
ID
JCDBG00023
Name
trnY-GUA
Type
tRNA
Scaffold
NC_012224.1
Start
34123
End
34206
Strand
-
Link
Genbank id:7636420
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
TGGGTCGATGCCCGAGCGGTTAATGGGGACGGACTGTAAATTCGTTGGCAATATGTCTACGCTGGTTCAAATCCAGCTCG GCCC
Gene structure

JCDB Genes gff download

JCDBG00023 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00023's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00023JCDBG00031co-exp0.821572
JCDBG00023JCDBG00040co-exp0.779813
JCDBG00023JCDBG00075co-exp0.750576
JCDBG00023JCDBG03764co-exp0.724676
JCDBG00023JCDBG13429co-exp0.721191
JCDBG00023JCDBG00050co-exp0.717153
JCDBG00023JCDBG00030co-exp0.715361
JCDBG00023JCDBG00028co-exp0.715146
JCDBG00023JCDBG01075co-exp0.712115
JCDBG00023JCDBG11239co-exp0.710705
JCDBG00031JCDBG00040co-exp0.851424
JCDBG00031JCDBG00075co-exp0.812056
JCDBG00031JCDBG03764co-exp0.751821
JCDBG00031JCDBG13429co-exp0.786635
JCDBG00031JCDBG00050co-exp0.81397
JCDBG00031JCDBG00030co-exp0.81722
JCDBG00031JCDBG00028co-exp0.802201
JCDBG00031JCDBG01075co-exp0.707522
JCDBG00031JCDBG11239co-exp0.751599
JCDBG00040JCDBG00075co-exp0.856433
JCDBG00040JCDBG03764co-exp0.819157
JCDBG00040JCDBG13429co-exp0.82403
JCDBG00040JCDBG00050co-exp0.85779
JCDBG00040JCDBG00030co-exp0.797195
JCDBG00040JCDBG00028co-exp0.863392
JCDBG00040JCDBG01075co-exp0.787303
JCDBG00040JCDBG11239co-exp0.791815
JCDBG00075JCDBG03764co-exp0.85047
JCDBG00075JCDBG13429co-exp0.933587
JCDBG00075JCDBG00050co-exp0.919816
JCDBG00075JCDBG00030co-exp0.774964
JCDBG00075JCDBG00028co-exp0.851903
JCDBG00075JCDBG01075co-exp0.888678
JCDBG00075JCDBG11239co-exp0.952265
JCDBG03764JCDBG13429co-exp0.884363
JCDBG03764JCDBG00050co-exp0.816355
JCDBG03764JCDBG00030co-exp0.692239
JCDBG03764JCDBG00028co-exp0.789117
JCDBG03764JCDBG01075co-exp0.839789
JCDBG03764JCDBG11239co-exp0.84327
JCDBG13429JCDBG00050co-exp0.890375
JCDBG13429JCDBG00030co-exp0.726329
JCDBG13429JCDBG00028co-exp0.812903
JCDBG13429JCDBG01075co-exp0.905879
JCDBG13429JCDBG11239co-exp0.923671
JCDBG00050JCDBG00030co-exp0.806102
JCDBG00050JCDBG00028co-exp0.913276
JCDBG00050JCDBG01075co-exp0.837234
JCDBG00050JCDBG11239co-exp0.877795
JCDBG00030JCDBG00028co-exp0.841768
JCDBG00030JCDBG01075co-exp0.665077
JCDBG00030JCDBG11239co-exp0.696915
JCDBG00028JCDBG01075co-exp0.776332
JCDBG00028JCDBG11239co-exp0.783048
JCDBG01075JCDBG11239co-exp0.897727
PPI network
node1node2type
JCDBR00023
ID
JCDBR00023
Name
JCDBR00023
Type
Scaffold
NC_012224.1
Start
34123
End
34206
Strand
-
Exon
34123-34206
Sequence
TGGGTCGATGCCCGAGCGGTTAATGGGGACGGACTGTAAATTCGTTGGCAATATGTCTACGCTGGTTCAAATCCAGCTCG GCCC
Product
tRNA-Tyr
Source
RefSeq
Link: