Detail information of JCDBG00024

JCDBG00024
ID
JCDBG00024
Name
trnE-UUC
Type
tRNA
Scaffold
NC_012224.1
Start
34266
End
34338
Strand
-
Link
Genbank id:7636421
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
TGCCCCCATCGTCTAGTGGTTCAGGACATCTCTCTTTCAAGGAGGCAGCGGGGATTCGACTTCCCCTGGGGGT
Gene structure

JCDB Genes gff download

JCDBG00024 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00024's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00024JCDBG14937co-exp0.63051
JCDBG00024JCDBG03768co-exp0.613891
JCDBG00024JCDBG21750co-exp0.610546
JCDBG00024JCDBG08418co-exp0.609722
JCDBG00024JCDBG11233co-exp0.607968
JCDBG00024JCDBG06821co-exp0.600888
JCDBG00024JCDBG03763co-exp0.600356
JCDBG14937JCDBG03768co-exp0.826459
JCDBG14937JCDBG21750co-exp0.678398
JCDBG14937JCDBG08418co-exp0.694256
JCDBG14937JCDBG11233co-exp0.749174
JCDBG14937JCDBG06821co-exp0.717935
JCDBG14937JCDBG03763co-exp0.673706
JCDBG03768JCDBG21750co-exp0.788703
JCDBG03768JCDBG08418co-exp0.693611
JCDBG03768JCDBG11233co-exp0.843705
JCDBG03768JCDBG06821co-exp0.851514
JCDBG03768JCDBG03763co-exp0.785106
JCDBG21750JCDBG08418co-exp0.660081
JCDBG21750JCDBG11233co-exp0.756154
JCDBG21750JCDBG06821co-exp0.69158
JCDBG21750JCDBG03763co-exp0.669446
JCDBG08418JCDBG11233co-exp0.785129
JCDBG08418JCDBG06821co-exp0.737876
JCDBG08418JCDBG03763co-exp0.648532
JCDBG11233JCDBG06821co-exp0.859924
JCDBG11233JCDBG03763co-exp0.755448
JCDBG06821JCDBG03763co-exp0.744063
PPI network
node1node2type
JCDBR00024
ID
JCDBR00024
Name
JCDBR00024
Type
Scaffold
NC_012224.1
Start
34266
End
34338
Strand
-
Exon
34266-34338
Sequence
TGCCCCCATCGTCTAGTGGTTCAGGACATCTCTCTTTCAAGGAGGCAGCGGGGATTCGACTTCCCCTGGGGGT
Product
tRNA-Glu
Source
RefSeq
Link: