Detail information of JCDBG00025

JCDBG00025
ID
JCDBG00025
Name
trnT_GGU
Type
tRNA
Scaffold
NC_012224.1
Start
35480
End
35551
Strand
+
Link
Genbank id:7636422
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
CCCTTTTAACTCAGTGGTAGAGTAACGCCATGGTAAGGCGTAAGTCATCGGTTCAAATCCGATAAGGGGCTT
Gene structure

JCDB Genes gff download

JCDBG00025 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00025
ID
JCDBR00025
Name
JCDBR00025
Type
Scaffold
NC_012224.1
Start
35480
End
35551
Strand
+
Exon
35480-35551
Sequence
CCCTTTTAACTCAGTGGTAGAGTAACGCCATGGTAAGGCGTAAGTCATCGGTTCAAATCCGATAAGGGGCTT
Product
tRNA-Thr
Source
RefSeq
Link: