Detail information of JCDBG00028

JCDBG00028
ID
JCDBG00028
Name
trnS-UGA
Type
tRNA
Scaffold
NC_012224.1
Start
39863
End
39951
Strand
-
Link
Genbank id:7636423
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGAGAGATGGCCGAGTGGTTGATAGCTCCGGTCTTGAAAACCGGTATAGTTCGCAAAGAACTATCGAGGGTTCGAATCCC TCTCTCTCC
Gene structure

JCDB Genes gff download

JCDBG00028 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00028's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00028JCDBG00050co-exp0.913276
JCDBG00028JCDBG00062co-exp0.880102
JCDBG00028JCDBG05077co-exp0.871127
JCDBG00028JCDBG23601co-exp0.869138
JCDBG00028JCDBG10494co-exp0.866123
JCDBG00028JCDBG00040co-exp0.863392
JCDBG00028JCDBG00059co-exp0.859519
JCDBG00028JCDBG00075co-exp0.851903
JCDBG00028JCDBG02094co-exp0.84968
JCDBG00028JCDBG18716co-exp0.847572
JCDBG00050JCDBG00062co-exp0.929095
JCDBG00050JCDBG05077co-exp0.865136
JCDBG00050JCDBG23601co-exp0.872699
JCDBG00050JCDBG10494co-exp0.858789
JCDBG00050JCDBG00040co-exp0.85779
JCDBG00050JCDBG00059co-exp0.913866
JCDBG00050JCDBG00075co-exp0.919816
JCDBG00050JCDBG02094co-exp0.86848
JCDBG00050JCDBG18716co-exp0.899046
JCDBG00062JCDBG05077co-exp0.826609
JCDBG00062JCDBG23601co-exp0.866219
JCDBG00062JCDBG10494co-exp0.825227
JCDBG00062JCDBG00040co-exp0.798414
JCDBG00062JCDBG00059co-exp0.900039
JCDBG00062JCDBG00075co-exp0.905767
JCDBG00062JCDBG02094co-exp0.879252
JCDBG00062JCDBG18716co-exp0.889956
JCDBG05077JCDBG23601co-exp0.858494
JCDBG05077JCDBG10494co-exp0.887476
JCDBG05077JCDBG00040co-exp0.827402
JCDBG05077JCDBG00059co-exp0.79826
JCDBG05077JCDBG00075co-exp0.828334
JCDBG05077JCDBG02094co-exp0.86982
JCDBG05077JCDBG18716co-exp0.875259
JCDBG23601JCDBG10494co-exp0.817332
JCDBG23601JCDBG00040co-exp0.779024
JCDBG23601JCDBG00059co-exp0.790822
JCDBG23601JCDBG00075co-exp0.901874
JCDBG23601JCDBG02094co-exp0.868182
JCDBG23601JCDBG18716co-exp0.914096
JCDBG10494JCDBG00040co-exp0.761693
JCDBG10494JCDBG00059co-exp0.808616
JCDBG10494JCDBG00075co-exp0.796915
JCDBG10494JCDBG02094co-exp0.839324
JCDBG10494JCDBG18716co-exp0.814082
JCDBG00040JCDBG00059co-exp0.769666
JCDBG00040JCDBG00075co-exp0.856433
JCDBG00040JCDBG02094co-exp0.774047
JCDBG00040JCDBG18716co-exp0.831643
JCDBG00059JCDBG00075co-exp0.844734
JCDBG00059JCDBG02094co-exp0.804018
JCDBG00059JCDBG18716co-exp0.805746
JCDBG00075JCDBG02094co-exp0.8282
JCDBG00075JCDBG18716co-exp0.940498
JCDBG02094JCDBG18716co-exp0.84699
PPI network
node1node2type
JCDBR00028
ID
JCDBR00028
Name
JCDBR00028
Type
Scaffold
NC_012224.1
Start
39863
End
39951
Strand
-
Exon
39863-39951
Sequence
GGAGAGATGGCCGAGTGGTTGATAGCTCCGGTCTTGAAAACCGGTATAGTTCGCAAAGAACTATCGAGGGTTCGAATCCC TCTCTCTCC
Product
tRNA-Ser
Source
RefSeq
Link: