Detail information of JCDBG00030

JCDBG00030
ID
JCDBG00030
Name
trnG-GCC
Type
tRNA
Scaffold
NC_012224.1
Start
41371
End
41441
Strand
+
Link
Genbank id:7636424
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
CGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCC
Gene structure

JCDB Genes gff download

JCDBG00030 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00030's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00030JCDBG00028co-exp0.841768
JCDBG00030JCDBG00031co-exp0.81722
JCDBG00030JCDBG00050co-exp0.806102
JCDBG00030JCDBG02902co-exp0.804146
JCDBG00030JCDBG00040co-exp0.797195
JCDBG00030JCDBG00062co-exp0.778448
JCDBG00030JCDBG00075co-exp0.774964
JCDBG00030JCDBG23601co-exp0.774751
JCDBG00030JCDBG10494co-exp0.77432
JCDBG00030JCDBG20934co-exp0.763232
JCDBG00028JCDBG00031co-exp0.802201
JCDBG00028JCDBG00050co-exp0.913276
JCDBG00028JCDBG02902co-exp0.764453
JCDBG00028JCDBG00040co-exp0.863392
JCDBG00028JCDBG00062co-exp0.880102
JCDBG00028JCDBG00075co-exp0.851903
JCDBG00028JCDBG23601co-exp0.869138
JCDBG00028JCDBG10494co-exp0.866123
JCDBG00028JCDBG20934co-exp0.766999
JCDBG00031JCDBG00050co-exp0.81397
JCDBG00031JCDBG02902co-exp0.779806
JCDBG00031JCDBG00040co-exp0.851424
JCDBG00031JCDBG00062co-exp0.72948
JCDBG00031JCDBG00075co-exp0.812056
JCDBG00031JCDBG23601co-exp0.733413
JCDBG00031JCDBG10494co-exp0.699036
JCDBG00031JCDBG20934co-exp0.761973
JCDBG00050JCDBG02902co-exp0.777437
JCDBG00050JCDBG00040co-exp0.85779
JCDBG00050JCDBG00062co-exp0.929095
JCDBG00050JCDBG00075co-exp0.919816
JCDBG00050JCDBG23601co-exp0.872699
JCDBG00050JCDBG10494co-exp0.858789
JCDBG00050JCDBG20934co-exp0.825708
JCDBG02902JCDBG00040co-exp0.842462
JCDBG02902JCDBG00062co-exp0.726666
JCDBG02902JCDBG00075co-exp0.813363
JCDBG02902JCDBG23601co-exp0.740741
JCDBG02902JCDBG10494co-exp0.687485
JCDBG02902JCDBG20934co-exp0.906393
JCDBG00040JCDBG00062co-exp0.798414
JCDBG00040JCDBG00075co-exp0.856433
JCDBG00040JCDBG23601co-exp0.779024
JCDBG00040JCDBG10494co-exp0.761693
JCDBG00040JCDBG20934co-exp0.818419
JCDBG00062JCDBG00075co-exp0.905767
JCDBG00062JCDBG23601co-exp0.866219
JCDBG00062JCDBG10494co-exp0.825227
JCDBG00062JCDBG20934co-exp0.765054
JCDBG00075JCDBG23601co-exp0.901874
JCDBG00075JCDBG10494co-exp0.796915
JCDBG00075JCDBG20934co-exp0.887012
JCDBG23601JCDBG10494co-exp0.817332
JCDBG23601JCDBG20934co-exp0.816845
JCDBG10494JCDBG20934co-exp0.712628
PPI network
node1node2type
JCDBR00030
ID
JCDBR00030
Name
JCDBR00030
Type
Scaffold
NC_012224.1
Start
41371
End
41441
Strand
+
Exon
41371-41441
Sequence
CGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCCCGCTATCCGCCC
Product
tRNA-Gly
Source
RefSeq
Link: