Detail information of JCDBG00031

JCDBG00031
ID
JCDBG00031
Name
trnfM-CAU
Type
tRNA
Scaffold
NC_012224.1
Start
41651
End
41724
Strand
-
Link
Genbank id:7636425
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
ACGCGGGGTAGAGCAGTTTGGTAGCTCGCAAGGCTCATAACCTTGAAGTCACGGGTTCAAATCCTGTCTCCGCA
Gene structure

JCDB Genes gff download

JCDBG00031 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00031's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00031JCDBG00040co-exp0.851424
JCDBG00031JCDBG00023co-exp0.821572
JCDBG00031JCDBG00030co-exp0.81722
JCDBG00031JCDBG00050co-exp0.81397
JCDBG00031JCDBG00075co-exp0.812056
JCDBG00031JCDBG00028co-exp0.802201
JCDBG00031JCDBG13429co-exp0.786635
JCDBG00031JCDBG02902co-exp0.779806
JCDBG00031JCDBG10160co-exp0.768187
JCDBG00031JCDBG16343co-exp0.765329
JCDBG00040JCDBG00023co-exp0.779813
JCDBG00040JCDBG00030co-exp0.797195
JCDBG00040JCDBG00050co-exp0.85779
JCDBG00040JCDBG00075co-exp0.856433
JCDBG00040JCDBG00028co-exp0.863392
JCDBG00040JCDBG13429co-exp0.82403
JCDBG00040JCDBG02902co-exp0.842462
JCDBG00040JCDBG10160co-exp0.845196
JCDBG00040JCDBG16343co-exp0.795325
JCDBG00023JCDBG00030co-exp0.715361
JCDBG00023JCDBG00050co-exp0.717153
JCDBG00023JCDBG00075co-exp0.750576
JCDBG00023JCDBG00028co-exp0.715146
JCDBG00023JCDBG13429co-exp0.721191
JCDBG00023JCDBG02902co-exp0.679259
JCDBG00023JCDBG10160co-exp0.660994
JCDBG00023JCDBG16343co-exp0.676536
JCDBG00030JCDBG00050co-exp0.806102
JCDBG00030JCDBG00075co-exp0.774964
JCDBG00030JCDBG00028co-exp0.841768
JCDBG00030JCDBG13429co-exp0.726329
JCDBG00030JCDBG02902co-exp0.804146
JCDBG00030JCDBG10160co-exp0.71717
JCDBG00030JCDBG16343co-exp0.700145
JCDBG00050JCDBG00075co-exp0.919816
JCDBG00050JCDBG00028co-exp0.913276
JCDBG00050JCDBG13429co-exp0.890375
JCDBG00050JCDBG02902co-exp0.777437
JCDBG00050JCDBG10160co-exp0.843355
JCDBG00050JCDBG16343co-exp0.886795
JCDBG00075JCDBG00028co-exp0.851903
JCDBG00075JCDBG13429co-exp0.933587
JCDBG00075JCDBG02902co-exp0.813363
JCDBG00075JCDBG10160co-exp0.837847
JCDBG00075JCDBG16343co-exp0.83708
JCDBG00028JCDBG13429co-exp0.812903
JCDBG00028JCDBG02902co-exp0.764453
JCDBG00028JCDBG10160co-exp0.789593
JCDBG00028JCDBG16343co-exp0.835975
JCDBG13429JCDBG02902co-exp0.807209
JCDBG13429JCDBG10160co-exp0.850421
JCDBG13429JCDBG16343co-exp0.840124
JCDBG02902JCDBG10160co-exp0.883654
JCDBG02902JCDBG16343co-exp0.715216
JCDBG10160JCDBG16343co-exp0.803555
PPI network
node1node2type
JCDBR00031
ID
JCDBR00031
Name
JCDBR00031
Type
Scaffold
NC_012224.1
Start
41651
End
41724
Strand
-
Exon
41651-41724
Sequence
ACGCGGGGTAGAGCAGTTTGGTAGCTCGCAAGGCTCATAACCTTGAAGTCACGGGTTCAAATCCTGTCTCCGCA
Product
tRNA-Met
Source
RefSeq
Link: