Detail information of JCDBG00036

JCDBG00036
ID
JCDBG00036
Name
trnS-GGA
Type
tRNA
Scaffold
NC_012224.1
Start
49826
End
49911
Strand
+
Link
Genbank id:7636426
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
AGAGATGGCCGAGTGGTTCAAGGCGTAGCATTGGAACTGCTATGTAGGCTTTTGTTTACCGAGGGTTCGAATCCCTCTCT TTCCGT
Gene structure

JCDB Genes gff download

JCDBG00036 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00036
ID
JCDBR00036
Name
JCDBR00036
Type
Scaffold
NC_012224.1
Start
49826
End
49911
Strand
+
Exon
49826-49911
Sequence
AGAGATGGCCGAGTGGTTCAAGGCGTAGCATTGGAACTGCTATGTAGGCTTTTGTTTACCGAGGGTTCGAATCCCTCTCT TTCCGT
Product
tRNA-Ser
Source
RefSeq
Link: