Detail information of JCDBG00038

JCDBG00038
ID
JCDBG00038
Name
trnT-UGU
Type
tRNA
Scaffold
NC_012224.1
Start
51195
End
51268
Strand
-
Link
Genbank id:7636427
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
AGCCCGCTTAGCTCAGAGGTTAGAGCATCGCATTTGTAATGCGATGGTCATCGGTTCGACTCCGATAGCTGGCT
Gene structure

JCDB Genes gff download

JCDBG00038 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00038's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00038JCDBG00031co-exp0.71258
JCDBG00038JCDBG00050co-exp0.688581
JCDBG00038JCDBG00040co-exp0.681785
JCDBG00038JCDBG00075co-exp0.673009
JCDBG00038JCDBG10597co-exp0.652161
JCDBG00038JCDBG00028co-exp0.651151
JCDBG00038JCDBG09290co-exp0.641168
JCDBG00038JCDBG20934co-exp0.639156
JCDBG00038JCDBG25126co-exp0.636128
JCDBG00038JCDBG18485co-exp0.632042
JCDBG00031JCDBG00050co-exp0.81397
JCDBG00031JCDBG00040co-exp0.851424
JCDBG00031JCDBG00075co-exp0.812056
JCDBG00031JCDBG10597co-exp0.749163
JCDBG00031JCDBG00028co-exp0.802201
JCDBG00031JCDBG09290co-exp0.679771
JCDBG00031JCDBG20934co-exp0.761973
JCDBG00031JCDBG25126co-exp0.74479
JCDBG00031JCDBG18485co-exp0.762457
JCDBG00050JCDBG00040co-exp0.85779
JCDBG00050JCDBG00075co-exp0.919816
JCDBG00050JCDBG10597co-exp0.875288
JCDBG00050JCDBG00028co-exp0.913276
JCDBG00050JCDBG09290co-exp0.790272
JCDBG00050JCDBG20934co-exp0.825708
JCDBG00050JCDBG25126co-exp0.828365
JCDBG00050JCDBG18485co-exp0.856565
JCDBG00040JCDBG00075co-exp0.856433
JCDBG00040JCDBG10597co-exp0.7848
JCDBG00040JCDBG00028co-exp0.863392
JCDBG00040JCDBG09290co-exp0.748997
JCDBG00040JCDBG20934co-exp0.818419
JCDBG00040JCDBG25126co-exp0.785498
JCDBG00040JCDBG18485co-exp0.811229
JCDBG00075JCDBG10597co-exp0.906944
JCDBG00075JCDBG00028co-exp0.851903
JCDBG00075JCDBG09290co-exp0.785231
JCDBG00075JCDBG20934co-exp0.887012
JCDBG00075JCDBG25126co-exp0.893152
JCDBG00075JCDBG18485co-exp0.894191
JCDBG10597JCDBG00028co-exp0.774115
JCDBG10597JCDBG09290co-exp0.876658
JCDBG10597JCDBG20934co-exp0.873414
JCDBG10597JCDBG25126co-exp0.930796
JCDBG10597JCDBG18485co-exp0.901244
JCDBG00028JCDBG09290co-exp0.752464
JCDBG00028JCDBG20934co-exp0.766999
JCDBG00028JCDBG25126co-exp0.744768
JCDBG00028JCDBG18485co-exp0.773347
JCDBG09290JCDBG20934co-exp0.788219
JCDBG09290JCDBG25126co-exp0.811352
JCDBG09290JCDBG18485co-exp0.795727
JCDBG20934JCDBG25126co-exp0.908334
JCDBG20934JCDBG18485co-exp0.913488
JCDBG25126JCDBG18485co-exp0.916477
PPI network
node1node2type
JCDBR00038
ID
JCDBR00038
Name
JCDBR00038
Type
Scaffold
NC_012224.1
Start
51195
End
51268
Strand
-
Exon
51195-51268
Sequence
AGCCCGCTTAGCTCAGAGGTTAGAGCATCGCATTTGTAATGCGATGGTCATCGGTTCGACTCCGATAGCTGGCT
Product
tRNA-Thr
Source
RefSeq
Link: