Detail information of JCDBG00039

JCDBG00039
ID
JCDBG00039
Name
trnL-UAA
Type
tRNA
Scaffold
NC_012224.1
Start
51732
End
52384
Strand
+
Link
Genbank id:7636428
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTC AAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAACAAACAAAGGTTCAAAA AGACAGAATAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTGCATTAG TAAAGTAAAGGAAAGGAATCCTTCCGTTAAAACTCCAGAAAGGATAAAGTAAAGGATAACCCTATATTCATATGTATACG TATTGAAATACTATCTCAAATGATTAAAATGATTAATAGGGGCCGAATCCATATTTTTTTTTTATCTTTATATTTATATG AAATTTTTATCTTTATATTTATATGAAAAATGAAATAAAAAAATTGTTTTGAATTGATTCCAAGTTGAAGAAAGGATTGA ATTTTAATTGATCAAATCATTCGCTCCATAGTCTGATAGATAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCATT CTACATGTCAATATCGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTC CCTCTATCCCCAA
Gene structure

JCDB Genes gff download

JCDBG00039 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00039's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00039JCDBG00044co-exp0.91683
JCDBG00039JCDBG18679co-exp0.804922
JCDBG00039JCDBG21393co-exp0.776809
JCDBG00039JCDBG00053co-exp0.680567
JCDBG00039JCDBG09720co-exp0.675831
JCDBG00039JCDBG00003co-exp0.663478
JCDBG00039JCDBG00851co-exp0.629475
JCDBG00044JCDBG18679co-exp0.736685
JCDBG00044JCDBG21393co-exp0.716597
JCDBG00044JCDBG00053co-exp0.619919
JCDBG00044JCDBG09720co-exp0.614104
JCDBG00044JCDBG00003co-exp0.808955
JCDBG18679JCDBG21393co-exp0.781255
JCDBG18679JCDBG00053co-exp0.680457
JCDBG18679JCDBG09720co-exp0.663406
JCDBG18679JCDBG00003co-exp0.671498
JCDBG18679JCDBG00851co-exp0.623803
JCDBG21393JCDBG00053co-exp0.666341
JCDBG09720JCDBG00851co-exp0.700654
JCDBG00003JCDBG00851co-exp0.713392
PPI network
node1node2type
JCDBR00039
ID
JCDBR00039
Name
JCDBR00039
Type
Scaffold
NC_012224.1
Start
51732
End
52384
Strand
+
Exon
51732-51768,52335-52384
Sequence
GGGATATGGCGAAATTGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATAACTTTC AAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAACAAACAAAGGTTCAAAA AGACAGAATAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTGCATTAG TAAAGTAAAGGAAAGGAATCCTTCCGTTAAAACTCCAGAAAGGATAAAGTAAAGGATAACCCTATATTCATATGTATACG TATTGAAATACTATCTCAAATGATTAAAATGATTAATAGGGGCCGAATCCATATTTTTTTTTTATCTTTATATTTATATG AAATTTTTATCTTTATATTTATATGAAAAATGAAATAAAAAAATTGTTTTGAATTGATTCCAAGTTGAAGAAAGGATTGA ATTTTAATTGATCAAATCATTCGCTCCATAGTCTGATAGATAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCATT CTACATGTCAATATCGACAACAAGGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTC CCTCTATCCCCAA
Product
tRNA-Leu
Source
RefSeq
Link: