Detail information of JCDBG00040

JCDBG00040
ID
JCDBG00040
Name
trnF-GAA
Type
tRNA
Scaffold
NC_012224.1
Start
52787
End
52859
Strand
+
Link
Genbank id:7636429
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
TCGGGATAGCTCAGCAGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCAGTTCAAGTCTGGTTCCTGACAC
Gene structure

JCDB Genes gff download

JCDBG00040 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00040's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00040JCDBG00028co-exp0.863392
JCDBG00040JCDBG00050co-exp0.85779
JCDBG00040JCDBG00075co-exp0.856433
JCDBG00040JCDBG00031co-exp0.851424
JCDBG00040JCDBG10160co-exp0.845196
JCDBG00040JCDBG02902co-exp0.842462
JCDBG00040JCDBG18716co-exp0.831643
JCDBG00040JCDBG05077co-exp0.827402
JCDBG00040JCDBG00061co-exp0.826591
JCDBG00040JCDBG09712co-exp0.824779
JCDBG00028JCDBG00050co-exp0.913276
JCDBG00028JCDBG00075co-exp0.851903
JCDBG00028JCDBG00031co-exp0.802201
JCDBG00028JCDBG10160co-exp0.789593
JCDBG00028JCDBG02902co-exp0.764453
JCDBG00028JCDBG18716co-exp0.847572
JCDBG00028JCDBG05077co-exp0.871127
JCDBG00028JCDBG00061co-exp0.847097
JCDBG00028JCDBG09712co-exp0.820917
JCDBG00050JCDBG00075co-exp0.919816
JCDBG00050JCDBG00031co-exp0.81397
JCDBG00050JCDBG10160co-exp0.843355
JCDBG00050JCDBG02902co-exp0.777437
JCDBG00050JCDBG18716co-exp0.899046
JCDBG00050JCDBG05077co-exp0.865136
JCDBG00050JCDBG00061co-exp0.845936
JCDBG00050JCDBG09712co-exp0.880884
JCDBG00075JCDBG00031co-exp0.812056
JCDBG00075JCDBG10160co-exp0.837847
JCDBG00075JCDBG02902co-exp0.813363
JCDBG00075JCDBG18716co-exp0.940498
JCDBG00075JCDBG05077co-exp0.828334
JCDBG00075JCDBG00061co-exp0.836833
JCDBG00075JCDBG09712co-exp0.899074
JCDBG00031JCDBG10160co-exp0.768187
JCDBG00031JCDBG02902co-exp0.779806
JCDBG00031JCDBG18716co-exp0.76006
JCDBG00031JCDBG05077co-exp0.734963
JCDBG00031JCDBG00061co-exp0.729573
JCDBG00031JCDBG09712co-exp0.74031
JCDBG10160JCDBG02902co-exp0.883654
JCDBG10160JCDBG18716co-exp0.817588
JCDBG10160JCDBG05077co-exp0.781996
JCDBG10160JCDBG00061co-exp0.763642
JCDBG10160JCDBG09712co-exp0.869366
JCDBG02902JCDBG18716co-exp0.730168
JCDBG02902JCDBG05077co-exp0.717244
JCDBG02902JCDBG00061co-exp0.720657
JCDBG02902JCDBG09712co-exp0.806228
JCDBG18716JCDBG05077co-exp0.875259
JCDBG18716JCDBG00061co-exp0.835003
JCDBG18716JCDBG09712co-exp0.880741
JCDBG05077JCDBG00061co-exp0.79748
JCDBG05077JCDBG09712co-exp0.873638
JCDBG00061JCDBG09712co-exp0.729732
PPI network
node1node2type
JCDBR00040
ID
JCDBR00040
Name
JCDBR00040
Type
Scaffold
NC_012224.1
Start
52787
End
52859
Strand
+
Exon
52787-52859
Sequence
TCGGGATAGCTCAGCAGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCAGTTCAAGTCTGGTTCCTGACAC
Product
tRNA-Phe
Source
RefSeq
Link: