Detail information of JCDBG00044

JCDBG00044
ID
JCDBG00044
Name
trnV-UAC
Type
tRNA
Scaffold
NC_012224.1
Start
56381
End
57040
Strand
-
Link
Genbank id:7636430
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
AAGGGCTATAGCTCAGTTAGGTAGAGCACCTCGTTTACACGCGCGCCACTGTTTTTTTCAAAGAAGTCCATCATGTAATC AAAAGACTTATTGAGAAGTCGATGTCTTACTCCATGATTTTTAGGGAACAAAAGAACAATAGCCTGACACAAAGGGTTCG GTCCAATTTAGGTGCCTTTTTAGACGCCGAACAGAACTCATCATTGATTTAAGGCCTTGATAGGGTGAATACCCAGTTTA TTCAATGCTAGGCATAATGAGTATAAGGACCTCAAAAAATTCTCTTTTCGTCCTATCCTATGAACTTTAAGGTGTATGAA GTTTCATATTTGATTCTTTAAGCAGAAGCGGGGCGGTGGAGATTCCATTTAACTTAGGTTAATTTAAGCCAAAAGCAGAC CTACGTCAGGATAACCTTTCTTTGAAACACTTTGGTAGTGCTCTCGGATCGGAATCCATAAATCAGAGCACATGGAGCCA TCTTCTTATCTTTCTGCCAAGAGAATTATGGTAGACTAACTGATTATTTATATCAGTTAATGAACGAGCCCAATGCAAAA AAATGCATGTTGGGTCTTTGAAAAAGTTCGAATCATTTTGATAATAATCAGTTTGATCTGTTTTACCGAGAAGGTCTACG GTTCGAGTCCGTATAGCCCT
Gene structure

JCDB Genes gff download

JCDBG00044 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00044's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00044JCDBG00039co-exp0.91683
JCDBG00044JCDBG00003co-exp0.808955
JCDBG00044JCDBG18679co-exp0.736685
JCDBG00044JCDBG25274co-exp0.72347
JCDBG00044JCDBG21393co-exp0.716597
JCDBG00044JCDBG00989co-exp0.660031
JCDBG00044JCDBG00053co-exp0.619919
JCDBG00044JCDBG09720co-exp0.614104
JCDBG00039JCDBG00003co-exp0.663478
JCDBG00039JCDBG18679co-exp0.804922
JCDBG00039JCDBG21393co-exp0.776809
JCDBG00039JCDBG00053co-exp0.680567
JCDBG00039JCDBG09720co-exp0.675831
JCDBG00003JCDBG18679co-exp0.671498
JCDBG00003JCDBG25274co-exp0.898339
JCDBG00003JCDBG00989co-exp0.823533
JCDBG18679JCDBG21393co-exp0.781255
JCDBG18679JCDBG00053co-exp0.680457
JCDBG18679JCDBG09720co-exp0.663406
JCDBG25274JCDBG00989co-exp0.736685
JCDBG21393JCDBG00053co-exp0.666341
PPI network
node1node2type
JCDBR00044
ID
JCDBR00044
Name
JCDBR00044
Type
Scaffold
NC_012224.1
Start
56381
End
57040
Strand
-
Exon
56381-56417,57002-57040
Sequence
AAGGGCTATAGCTCAGTTAGGTAGAGCACCTCGTTTACACGCGCGCCACTGTTTTTTTCAAAGAAGTCCATCATGTAATC AAAAGACTTATTGAGAAGTCGATGTCTTACTCCATGATTTTTAGGGAACAAAAGAACAATAGCCTGACACAAAGGGTTCG GTCCAATTTAGGTGCCTTTTTAGACGCCGAACAGAACTCATCATTGATTTAAGGCCTTGATAGGGTGAATACCCAGTTTA TTCAATGCTAGGCATAATGAGTATAAGGACCTCAAAAAATTCTCTTTTCGTCCTATCCTATGAACTTTAAGGTGTATGAA GTTTCATATTTGATTCTTTAAGCAGAAGCGGGGCGGTGGAGATTCCATTTAACTTAGGTTAATTTAAGCCAAAAGCAGAC CTACGTCAGGATAACCTTTCTTTGAAACACTTTGGTAGTGCTCTCGGATCGGAATCCATAAATCAGAGCACATGGAGCCA TCTTCTTATCTTTCTGCCAAGAGAATTATGGTAGACTAACTGATTATTTATATCAGTTAATGAACGAGCCCAATGCAAAA AAATGCATGTTGGGTCTTTGAAAAAGTTCGAATCATTTTGATAATAATCAGTTTGATCTGTTTTACCGAGAAGGTCTACG GTTCGAGTCCGTATAGCCCT
Product
tRNA-Val
Source
RefSeq
Link: