Detail information of JCDBG00060

JCDBG00060
ID
JCDBG00060
Name
trnW-CCA
Type
tRNA
Scaffold
NC_012224.1
Start
72378
End
72452
Strand
-
Link
Genbank id:7636432
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
AGCGCTCTTAGTTCAGTTAGGTAGAACGTGGGTCTCCAAAACCCAATGTCGTAGGTTCAAATCCTACAGAGCGCG
Gene structure

JCDB Genes gff download

JCDBG00060 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00060's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00060JCDBG09415co-exp0.751618
JCDBG00060JCDBG16071co-exp0.742733
JCDBG00060JCDBG16013co-exp0.742457
JCDBG00060JCDBG18483co-exp0.739237
JCDBG00060JCDBG19397co-exp0.735112
JCDBG00060JCDBG25166co-exp0.733188
JCDBG00060JCDBG10987co-exp0.732551
JCDBG00060JCDBG24584co-exp0.726745
JCDBG00060JCDBG00777co-exp0.725719
JCDBG00060JCDBG00061co-exp0.723122
JCDBG09415JCDBG16071co-exp0.749934
JCDBG09415JCDBG16013co-exp0.864972
JCDBG09415JCDBG18483co-exp0.854463
JCDBG09415JCDBG19397co-exp0.931324
JCDBG09415JCDBG25166co-exp0.875945
JCDBG09415JCDBG10987co-exp0.719038
JCDBG09415JCDBG24584co-exp0.92619
JCDBG09415JCDBG00777co-exp0.881639
JCDBG09415JCDBG00061co-exp0.748812
JCDBG16071JCDBG16013co-exp0.708985
JCDBG16071JCDBG18483co-exp0.669678
JCDBG16071JCDBG19397co-exp0.712188
JCDBG16071JCDBG25166co-exp0.744726
JCDBG16071JCDBG10987co-exp0.803056
JCDBG16071JCDBG24584co-exp0.701615
JCDBG16071JCDBG00777co-exp0.668938
JCDBG16071JCDBG00061co-exp0.622907
JCDBG16013JCDBG18483co-exp0.790189
JCDBG16013JCDBG19397co-exp0.846034
JCDBG16013JCDBG25166co-exp0.859111
JCDBG16013JCDBG10987co-exp0.693451
JCDBG16013JCDBG24584co-exp0.845396
JCDBG16013JCDBG00777co-exp0.807285
JCDBG16013JCDBG00061co-exp0.689503
JCDBG18483JCDBG19397co-exp0.918325
JCDBG18483JCDBG25166co-exp0.795957
JCDBG18483JCDBG10987co-exp0.610967
JCDBG18483JCDBG24584co-exp0.882812
JCDBG18483JCDBG00777co-exp0.849284
JCDBG18483JCDBG00061co-exp0.616909
JCDBG19397JCDBG25166co-exp0.900066
JCDBG19397JCDBG10987co-exp0.691876
JCDBG19397JCDBG24584co-exp0.94852
JCDBG19397JCDBG00777co-exp0.951223
JCDBG19397JCDBG00061co-exp0.76033
JCDBG25166JCDBG10987co-exp0.735736
JCDBG25166JCDBG24584co-exp0.87436
JCDBG25166JCDBG00777co-exp0.885649
JCDBG25166JCDBG00061co-exp0.76921
JCDBG10987JCDBG24584co-exp0.692117
JCDBG10987JCDBG00777co-exp0.657015
JCDBG10987JCDBG00061co-exp0.672605
JCDBG24584JCDBG00777co-exp0.918966
JCDBG24584JCDBG00061co-exp0.760413
JCDBG00777JCDBG00061co-exp0.828044
PPI network
node1node2type
JCDBR00060
ID
JCDBR00060
Name
JCDBR00060
Type
Scaffold
NC_012224.1
Start
72378
End
72452
Strand
-
Exon
72378-72452
Sequence
AGCGCTCTTAGTTCAGTTAGGTAGAACGTGGGTCTCCAAAACCCAATGTCGTAGGTTCAAATCCTACAGAGCGCG
Product
tRNA-Trp
Source
RefSeq
Link: