Detail information of JCDBG00061

JCDBG00061
ID
JCDBG00061
Name
trnP-UGG
Type
tRNA
Scaffold
NC_012224.1
Start
72646
End
72716
Strand
-
Link
Genbank id:7636433
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
AGGGATGTAGCGCAGCTTGGTAGCGCGTTTGTTTTGGGTACAAAATGTCACGGGTTCAAATCCTGTCATCC
Gene structure

JCDB Genes gff download

JCDBG00061 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00061's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00061JCDBG00028co-exp0.847097
JCDBG00061JCDBG00050co-exp0.845936
JCDBG00061JCDBG00075co-exp0.836833
JCDBG00061JCDBG18716co-exp0.835003
JCDBG00061JCDBG00777co-exp0.828044
JCDBG00061JCDBG00040co-exp0.826591
JCDBG00061JCDBG00062co-exp0.82273
JCDBG00061JCDBG10494co-exp0.803135
JCDBG00061JCDBG22331co-exp0.800151
JCDBG00061JCDBG05077co-exp0.79748
JCDBG00028JCDBG00050co-exp0.913276
JCDBG00028JCDBG00075co-exp0.851903
JCDBG00028JCDBG18716co-exp0.847572
JCDBG00028JCDBG00777co-exp0.825133
JCDBG00028JCDBG00040co-exp0.863392
JCDBG00028JCDBG00062co-exp0.880102
JCDBG00028JCDBG10494co-exp0.866123
JCDBG00028JCDBG22331co-exp0.798587
JCDBG00028JCDBG05077co-exp0.871127
JCDBG00050JCDBG00075co-exp0.919816
JCDBG00050JCDBG18716co-exp0.899046
JCDBG00050JCDBG00777co-exp0.899601
JCDBG00050JCDBG00040co-exp0.85779
JCDBG00050JCDBG00062co-exp0.929095
JCDBG00050JCDBG10494co-exp0.858789
JCDBG00050JCDBG22331co-exp0.885211
JCDBG00050JCDBG05077co-exp0.865136
JCDBG00075JCDBG18716co-exp0.940498
JCDBG00075JCDBG00777co-exp0.900444
JCDBG00075JCDBG00040co-exp0.856433
JCDBG00075JCDBG00062co-exp0.905767
JCDBG00075JCDBG10494co-exp0.796915
JCDBG00075JCDBG22331co-exp0.908335
JCDBG00075JCDBG05077co-exp0.828334
JCDBG18716JCDBG00777co-exp0.893376
JCDBG18716JCDBG00040co-exp0.831643
JCDBG18716JCDBG00062co-exp0.889956
JCDBG18716JCDBG10494co-exp0.814082
JCDBG18716JCDBG22331co-exp0.877676
JCDBG18716JCDBG05077co-exp0.875259
JCDBG00777JCDBG00040co-exp0.8051
JCDBG00777JCDBG00062co-exp0.892505
JCDBG00777JCDBG10494co-exp0.848094
JCDBG00777JCDBG22331co-exp0.943312
JCDBG00777JCDBG05077co-exp0.811025
JCDBG00040JCDBG00062co-exp0.798414
JCDBG00040JCDBG10494co-exp0.761693
JCDBG00040JCDBG22331co-exp0.771805
JCDBG00040JCDBG05077co-exp0.827402
JCDBG00062JCDBG10494co-exp0.825227
JCDBG00062JCDBG22331co-exp0.870626
JCDBG00062JCDBG05077co-exp0.826609
JCDBG10494JCDBG22331co-exp0.803381
JCDBG10494JCDBG05077co-exp0.887476
JCDBG22331JCDBG05077co-exp0.777499
PPI network
node1node2type
JCDBR00061
ID
JCDBR00061
Name
JCDBR00061
Type
Scaffold
NC_012224.1
Start
72646
End
72716
Strand
-
Exon
72646-72716
Sequence
AGGGATGTAGCGCAGCTTGGTAGCGCGTTTGTTTTGGGTACAAAATGTCACGGGTTCAAATCCTGTCATCC
Product
tRNA-Pro
Source
RefSeq
Link: