Detail information of JCDBG00084

JCDBG00084
ID
JCDBG00084
Name
trnI-CAU
Type
tRNA
Scaffold
NC_012224.1
Start
93690
End
93763
Strand
-
Link
Genbank id:7636388
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
AGCATCCATGGCTGAATGGTTAAAGCGCCCAACTCATAATTGGCGAATTCGTAGGTTCAATTCCTACTGGATGC
Gene structure

JCDB Genes gff download

JCDBG00084 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00084
ID
JCDBR00084
Name
JCDBR00084
Type
Scaffold
NC_012224.1
Start
93690
End
93763
Strand
-
Exon
93690-93763
Sequence
AGCATCCATGGCTGAATGGTTAAAGCGCCCAACTCATAATTGGCGAATTCGTAGGTTCAATTCCTACTGGATGC
Product
tRNA-Ile
Source
RefSeq
Link: