Detail information of JCDBG00087

JCDBG00087
ID
JCDBG00087
Name
trnL-CAA
Type
tRNA
Scaffold
NC_012224.1
Start
101740
End
101819
Strand
-
Link
Genbank id:7636389
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
TGCCTTGGTGGTGAAATGGTAGACACGCGAGACTCAAAATCTCGTGCTAAAGAGCGTGGAGGTTCGAGTCCTCTTCAAGG
Gene structure

JCDB Genes gff download

JCDBG00087 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00087
ID
JCDBR00087
Name
JCDBR00087
Type
Scaffold
NC_012224.1
Start
101740
End
101819
Strand
-
Exon
101740-101819
Sequence
TGCCTTGGTGGTGAAATGGTAGACACGCGAGACTCAAAATCTCGTGCTAAAGAGCGTGGAGGTTCGAGTCCTCTTCAAGG
Product
tRNA-Leu
Source
RefSeq
Link: