Detail information of JCDBG00090

JCDBG00090
ID
JCDBG00090
Name
trnV-GAC
Type
tRNA
Scaffold
NC_012224.1
Start
107754
End
107825
Strand
+
Link
Genbank id:7636390
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGGATATAACTCAGCGGTAGAGTGTCACCTTGACGTGGTGGAAGTCATCAGTTCGAGCCTGATTATCCCTAA
Gene structure

JCDB Genes gff download

JCDBG00090 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00090
ID
JCDBR00090
Name
JCDBR00090
Type
Scaffold
NC_012224.1
Start
107754
End
107825
Strand
+
Exon
107754-107825
Sequence
GGGATATAACTCAGCGGTAGAGTGTCACCTTGACGTGGTGGAAGTCATCAGTTCGAGCCTGATTATCCCTAA
Product
tRNA-Val
Source
RefSeq
Link: