Detail information of JCDBG00092

JCDBG00092
ID
JCDBG00092
Name
trnI-GAU
Type
tRNA
Scaffold
NC_012224.1
Start
109835
End
110860
Strand
+
Link
Genbank id:7636392
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGCTATTAGCTCAGTGGTAGAGCGCGCCCCTGATAATTGCGTCGTTGTGCCTGGGCTGTGAGGGCTCTCAGCCACATGGA TAGTTCAATGTGCTCATCAGCGCCTGACCCTGAGATGTGGATCATCCAAGGCACATTAGCATGGCGTACTTCTCCTGTTC GAACCGGGGTTTGAAACCAAACTTCTCCTCAGGAGGATAGATGGGGCGATTCAGGTGAGATCCAATGTAGATCCAACTTT CTATTCACTCGTGGGATCCGGGCGGTCCGGGGGGGACCACCACGGCTCCTCTCTTCTCGAGAATCCATACATCCCTTATC AATGTATGGACAGCTATCTCTCGAGCACAGGTTTAGGTTCGGCCTCAATGGGAAAATAAAATGGAGCACCTAACAACGTA TCTTCACAGACCAAGAACTACGAGATCGCCCCTTTCATTCTGGGGCGACGGAGGGATCGTACCATTCGAGCCTTTTTTTT CATGCTTTTCCCGGAGGTCTGGAGAAAGCTGCAATCAATAGGATTTTCCTAACCCTCCCTTCCCGAAAGGCGAAAGGAAG GAGGTGAAATTCTTTTTCCTTTCCGCAGGGACCAGGAGATTGGATCTAGCCGTAAGAAGAATGCTTGGCTGATAAATAAC TCACTTCTTGGTCTTCGACCCCCTCAGTCACTACGAACGCCCCCGGTCAGTGCAATGGGATGTGTCTATTTATCTATCTC TTGACTCGAAATGGGAGTAGGTTTGAAAAAGGATCTTAGAGTGTCTAAGGTGGGGCCAGGAGGGTCTCTTAACGCCTTCT TTTTCTTCTCATCGGAGTTATTTCAAAAAGACTTGCCATGGTAAGGAAGAAGGGGAGAACAAGCACACTTGGAGAGCGCA GTACAACGAAGAATTGTATGCTGCGTTCGGGAAGGATGAATCGCTCCCGAAAAGGAATCTATTGATTCTCTCCCAATTAG TTGGACCGTAGGTGCGATGATTTACTTCACGGGCGAGGTCTCTGGTTCAAGTCCAGGATGGCCCAG
Gene structure

JCDB Genes gff download

JCDBG00092 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00092
ID
JCDBR00092
Name
JCDBR00092
Type
Scaffold
NC_012224.1
Start
109835
End
110860
Strand
+
Exon
109835-109871,110826-110860
Sequence
GGCTATTAGCTCAGTGGTAGAGCGCGCCCCTGATAATTGCGTCGTTGTGCCTGGGCTGTGAGGGCTCTCAGCCACATGGA TAGTTCAATGTGCTCATCAGCGCCTGACCCTGAGATGTGGATCATCCAAGGCACATTAGCATGGCGTACTTCTCCTGTTC GAACCGGGGTTTGAAACCAAACTTCTCCTCAGGAGGATAGATGGGGCGATTCAGGTGAGATCCAATGTAGATCCAACTTT CTATTCACTCGTGGGATCCGGGCGGTCCGGGGGGGACCACCACGGCTCCTCTCTTCTCGAGAATCCATACATCCCTTATC AATGTATGGACAGCTATCTCTCGAGCACAGGTTTAGGTTCGGCCTCAATGGGAAAATAAAATGGAGCACCTAACAACGTA TCTTCACAGACCAAGAACTACGAGATCGCCCCTTTCATTCTGGGGCGACGGAGGGATCGTACCATTCGAGCCTTTTTTTT CATGCTTTTCCCGGAGGTCTGGAGAAAGCTGCAATCAATAGGATTTTCCTAACCCTCCCTTCCCGAAAGGCGAAAGGAAG GAGGTGAAATTCTTTTTCCTTTCCGCAGGGACCAGGAGATTGGATCTAGCCGTAAGAAGAATGCTTGGCTGATAAATAAC TCACTTCTTGGTCTTCGACCCCCTCAGTCACTACGAACGCCCCCGGTCAGTGCAATGGGATGTGTCTATTTATCTATCTC TTGACTCGAAATGGGAGTAGGTTTGAAAAAGGATCTTAGAGTGTCTAAGGTGGGGCCAGGAGGGTCTCTTAACGCCTTCT TTTTCTTCTCATCGGAGTTATTTCAAAAAGACTTGCCATGGTAAGGAAGAAGGGGAGAACAAGCACACTTGGAGAGCGCA GTACAACGAAGAATTGTATGCTGCGTTCGGGAAGGATGAATCGCTCCCGAAAAGGAATCTATTGATTCTCTCCCAATTAG TTGGACCGTAGGTGCGATGATTTACTTCACGGGCGAGGTCTCTGGTTCAAGTCCAGGATGGCCCAG
Product
tRNA-Ile
Source
RefSeq
Link: