Detail information of JCDBG00093

JCDBG00093
ID
JCDBG00093
Name
trnA_UGC
Type
tRNA
Scaffold
NC_012224.1
Start
110925
End
111795
Strand
+
Link
Genbank id:7636393
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGGATATAGCTCAGTTGGTAGAGCTCCGCTCTTGCAATTGGGTCGTTGCGATTACGGGTTGGATGTCTAATTGTCCAGGC GGTAATGATAGTATCTTGTACCTGAACCGGTGGCTCACTTTTTCTAAATAATGGGGAAGAGGACCGAAACATGCCACTGA AAGACTCTACTGAGACAAAGATGGGCTGTCAAGAACGTAGAGGAGGTAAGATGGGCAGTTGGTCAGATCTAGTATGGATC GTACATGGACGATAGTTGGAGTCGGCGGCTCTCCTAGGGTTCCCTCATCTGGGATCCCTGGGGAAGAGGATCAAGTTGGC CCTTGCGAACAGCTTGATGCACTATCTCCCTTCAACCCTTTAGCGAAATGCGGCAAAAGGAAGGAAAATCCATGGACCGA CCCCATCGTCTCCACCCCGTAGGAACTACGAGATCACCCCAAGGACGCCTTCGGCATCCAGGGGTCGCGGACCGACCATA GAACCCTGTTCAATAAGTGGAACGCATTAGCTGTCCGCTCTCAGGTTGGGCAGTAAGGGTCGGAGAAGGGCAATCACTCA TTCTTAAAATCAGCATTCTTAAGACCAAAGAGTGGGCGGAAAAAGGGGGGGCTCCCCGTTCCTAGTTTTCCTGTAGCTGG ATCCTCCGGAACCACAAGAGTCCTTAGTTAGAATGGGATTCCAACTCAGCACCTTTTGAGATTTTGAGAAGAGTTGCTCT TTGGAGAGCACAGTACGATGAAAGTTGTAAGCTGTGTTCGGGGGGGAGTTATTGTCTATCGTTGGCCTCTATGGTAGAAT CAGTCGGGGGCCCGAGAGGCGGTGGTTTACCCTGTGGCGGATGTCAGCGGTTCGAGTCCGCTTATCTCCAA
Gene structure

JCDB Genes gff download

JCDBG00093 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00093
ID
JCDBR00093
Name
JCDBR00093
Type
Scaffold
NC_012224.1
Start
110925
End
111795
Strand
+
Exon
110925-110962,111761-111795
Sequence
GGGATATAGCTCAGTTGGTAGAGCTCCGCTCTTGCAATTGGGTCGTTGCGATTACGGGTTGGATGTCTAATTGTCCAGGC GGTAATGATAGTATCTTGTACCTGAACCGGTGGCTCACTTTTTCTAAATAATGGGGAAGAGGACCGAAACATGCCACTGA AAGACTCTACTGAGACAAAGATGGGCTGTCAAGAACGTAGAGGAGGTAAGATGGGCAGTTGGTCAGATCTAGTATGGATC GTACATGGACGATAGTTGGAGTCGGCGGCTCTCCTAGGGTTCCCTCATCTGGGATCCCTGGGGAAGAGGATCAAGTTGGC CCTTGCGAACAGCTTGATGCACTATCTCCCTTCAACCCTTTAGCGAAATGCGGCAAAAGGAAGGAAAATCCATGGACCGA CCCCATCGTCTCCACCCCGTAGGAACTACGAGATCACCCCAAGGACGCCTTCGGCATCCAGGGGTCGCGGACCGACCATA GAACCCTGTTCAATAAGTGGAACGCATTAGCTGTCCGCTCTCAGGTTGGGCAGTAAGGGTCGGAGAAGGGCAATCACTCA TTCTTAAAATCAGCATTCTTAAGACCAAAGAGTGGGCGGAAAAAGGGGGGGCTCCCCGTTCCTAGTTTTCCTGTAGCTGG ATCCTCCGGAACCACAAGAGTCCTTAGTTAGAATGGGATTCCAACTCAGCACCTTTTGAGATTTTGAGAAGAGTTGCTCT TTGGAGAGCACAGTACGATGAAAGTTGTAAGCTGTGTTCGGGGGGGAGTTATTGTCTATCGTTGGCCTCTATGGTAGAAT CAGTCGGGGGCCCGAGAGGCGGTGGTTTACCCTGTGGCGGATGTCAGCGGTTCGAGTCCGCTTATCTCCAA
Product
tRNA-Ala
Source
RefSeq
Link: