Detail information of JCDBG00095

JCDBG00095
ID
JCDBG00095
Name
rrn4.5
Type
rRNA
Scaffold
NC_012224.1
Start
114871
End
114973
Strand
+
Link
Genbank id:7636395
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
AAGGTCACGGCGAGACGAGCCGTTTATCATTACGATAGGTGTCAAGTGGAAGTGCAGTGATGTATGCAGCTGAGGCATCC TAACAGACCGGTAGACTTGAACC
Gene structure

JCDB Genes gff download

JCDBG00095 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00095
ID
JCDBR00095
Name
JCDBR00095
Type
Scaffold
NC_012224.1
Start
114871
End
114973
Strand
+
Exon
114871-114973
Sequence
AAGGTCACGGCGAGACGAGCCGTTTATCATTACGATAGGTGTCAAGTGGAAGTGCAGTGATGTATGCAGCTGAGGCATCC TAACAGACCGGTAGACTTGAACC
Product
rrn4.5
Source
RefSeq
Link: