Detail information of JCDBG00096

JCDBG00096
ID
JCDBG00096
Name
rrn5
Type
rRNA
Scaffold
NC_012224.1
Start
115205
End
115324
Strand
+
Link
Genbank id:7636396
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
TTCTGGTGTCCTAGGCGTAGAGGAACCACACCAATCCATCCCGAACTTGGTGGTTAAACTCTACTGCGGTGAAGATACTG TAGGGGAGGTCCTGCGGAAAAATAGCTCGACGCCAGGATG
Gene structure

JCDB Genes gff download

JCDBG00096 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00096
ID
JCDBR00096
Name
JCDBR00096
Type
Scaffold
NC_012224.1
Start
115205
End
115324
Strand
+
Exon
115205-115324
Sequence
TTCTGGTGTCCTAGGCGTAGAGGAACCACACCAATCCATCCCGAACTTGGTGGTTAAACTCTACTGCGGTGAAGATACTG TAGGGGAGGTCCTGCGGAAAAATAGCTCGACGCCAGGATG
Product
rrn5
Source
RefSeq
Link: