Detail information of JCDBG00097

JCDBG00097
ID
JCDBG00097
Name
trnR-ACG
Type
tRNA
Scaffold
NC_012224.1
Start
115564
End
115637
Strand
+
Link
Genbank id:7636397
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGCCTGTAGCTCAGAGGATTAGAGCACGTGGCTACGAACCACGGTGTCGGGGGTTCGAATCCCTCCTCGCCCAC
Gene structure

JCDB Genes gff download

JCDBG00097 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00097
ID
JCDBR00097
Name
JCDBR00097
Type
Scaffold
NC_012224.1
Start
115564
End
115637
Strand
+
Exon
115564-115637
Sequence
GGCCTGTAGCTCAGAGGATTAGAGCACGTGGCTACGAACCACGGTGTCGGGGGTTCGAATCCCTCCTCGCCCAC
Product
tRNA-Arg
Source
RefSeq
Link: