Detail information of JCDBG00098

JCDBG00098
ID
JCDBG00098
Name
trnN-GUU
Type
tRNA
Scaffold
NC_012224.1
Start
116256
End
116327
Strand
-
Link
Genbank id:7636398
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
TTCCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACTGACTGGTCGTAGGTTCGAATCCTACTTGGGGA
Gene structure

JCDB Genes gff download

JCDBG00098 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00098
ID
JCDBR00098
Name
JCDBR00098
Type
Scaffold
NC_012224.1
Start
116256
End
116327
Strand
-
Exon
116256-116327
Sequence
TTCCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACTGACTGGTCGTAGGTTCGAATCCTACTTGGGGA
Product
tRNA-Asn
Source
RefSeq
Link: