Detail information of JCDBG00099

JCDBG00099
ID
JCDBG00099
Name
ycf1
Type
pseudogene
Scaffold
NC_012224.1
Start
116669
End
118869
Strand
+
Link
Genbank id:7636399
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
TGATTTTGAAATCTTTTATACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTC TATTATGGATTTCTGACCACATTCTCCACGGGGCCCTCTTATCTCTTCCTTCTTCGAGCTCGGGTTATAGAAGAAGGAGA AGAAGGAACTGAGAAGAAGGTATCAGCAACAACAGGTTTTATTACGGGACAGCTCATGATGTTCATATCGATCTATTATG CGCCTCTGCATCTAGCATTGGGTAGACCTCATACAATAACTGTCCTAGCTCTACCCTATCTTTTGTTTCATTTCTTCTGG AACAATCACAAACACTTTTTTGATTATGGATCTACTACCAGAAATTCAATGCGTAATCTTAGCATTCAATTTGTATTCCT GAATAATCTCATTTTTCAATTATTCAACCATTTCATTTTACCAAGTTCAATGTTAGTCAGATTAGTCAACATTTATATGT TTCGATGCAACAACAAGATGTTATTTGTAACAAGTAGTTTTGTTGGTTGGTTAATTGGTCACATTTTATTCATGAAATGG GTTGGATTGATATTAGTCTGGATACAGCAAAATAATTCTATTAGATCGAATGTACTTTTTCGATCTAATAAGTACCTTGT GTCAGAATTGAGAAATTCTATGGCTCGAATCTTTAGTATTCTCTTATTTATTACCTGTGTCTACTCTTTAGGCAGAATAC CGTCACCCATTTTTACTAAGAAACTGAAAGAAACCTCAGAAGCGGAAGAAAGGGAGGAAGAAACAGATGTAGAAATAGAA ACAACTTCCGAAACGAAGGGGACTAAACAGGAACAAGAGGGATCCACCGAAGAAGATCCTTCTTCTTCCCTTTTTTCGGA AGAAAAGGAGGATCCGGACAAAATCGACGAAACGGAAGAGATCCAAGTGAATGGAAAGGAAAAAACAAAGGATGAATTCC ATTTTCACTTTAAAGAGACATGCTATAAAAATAGACCACTTTATGAAACTTTTTATCTGGATGGGAATCAAGAAAATTCG AAGTTAGAAATATTGATAGATAAAAAAAATAAAGATCTTTTCTGGTTTGAAAAACCTCTTGTAACTATTCTTTTTGACTC TAAACGTTGGAATCGTCCATTTCGATATATAAAAAATGATCAGTTTGAGAATGCTGTAAGAAAAGAAATGTCACAATATT TTTTTTATACATGTCGAAGTGATGGAAAAGAAAGAATATCTTTTACGTATCCACCCAGTTTGTCAACTTTTTTGGAAATG ATACAAAGAAGGATGTCCCTGTTTACAACAGAAAAACTCTCCTCCGATGAATTGTATAATCGTTGGAATTATAAGAATGA ACAAAAAAAGAAAAATCTAAGTAATGAATTTATAAAAAGAGTCCAGGCTTTAGATAAGGGATATCTTGCTCTGAATACAC TCCAAAAAAGGACTAGATTGTGTAATGATAAAACTAAAAAAGAGTACTTACCTAAAATATATGATCCCTTATTGAGTGGG TCATACCGCGGAAAAATCCAATTTTTTTTTTCACCCTCAATTTTAAATAAAACTTCCATAAAAAATTCTATAGAGATGGT TTGGATAAATAAAATTCATCTTTTTCTTCTTATTACTAATTATCAAAAATTCGAACCAAAAACAGATGTAAAATCATTTT CAACAGAAATTGCTTATTTCTTAAACTTAATTAATGAATTTGCCGGAAAATCAAGATCGAGTTTAAATTTTAAGGAACTC TCTTTATTTCCAGATCACAAAGAAGAAAAAATGGATTTAGAAAATCGAATAAAAATTTTCAAATTTTTATTTGATACAGT TATCGCGAATTCAAAAAATAAAACAATTAGAAATAATTCTATTGGAATAAAAGAAATAAGTAAACAAGTTCCTCGATGGT CATATAAATTAATTGACGATTTGGAACAACAAGAGGGAGAAAATGAAGAAAATGAAGAAAACATGGCGGAAGATCATGAA ATTCGTTCACGAAAAGCCAAACGTGTAGTGATTTTTACTGATAATCAACAAAATACTGAGACTTATAATAATACCAAAGA TACAACGAATTCTGATCAAATAGACAAAGTGACTTTGATACGTTATTCACAACAATCGGACTTTCGTCGAGACATAATAA AAGGATCTATGCGAGCACAAAGACGCAAAATACCTATATTT
Gene structure

JCDB Genes gff download

JCDBG00099 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.