Detail information of JCDBG00102

JCDBG00102
ID
JCDBG00102
Name
trnL-UAG
Type
tRNA
Scaffold
NC_012224.1
Start
123144
End
123222
Strand
+
Link
Genbank id:7636400
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
CGCTATGGTGAAATCGGTAGACACGCTGCTCTTAGGAAGCAGTGCTAGAGCATCTCGGTTCGAGTCCGAGTAGCGGCAT
Gene structure

JCDB Genes gff download

JCDBG00102 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00102's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00102JCDBG01804co-exp0.710219
JCDBG00102JCDBG21805co-exp0.671741
JCDBG00102JCDBG06107co-exp0.658719
JCDBG00102JCDBG06821co-exp0.644441
JCDBG00102JCDBG03740co-exp0.638348
JCDBG00102JCDBG02116co-exp0.636318
JCDBG00102JCDBG02827co-exp0.635147
JCDBG00102JCDBG09535co-exp0.632403
JCDBG00102JCDBG21804co-exp0.63048
JCDBG00102JCDBG02218co-exp0.629503
JCDBG01804JCDBG21805co-exp0.831525
JCDBG01804JCDBG06107co-exp0.772501
JCDBG01804JCDBG06821co-exp0.799356
JCDBG01804JCDBG03740co-exp0.676204
JCDBG01804JCDBG02116co-exp0.797565
JCDBG01804JCDBG02827co-exp0.794665
JCDBG01804JCDBG09535co-exp0.79427
JCDBG01804JCDBG21804co-exp0.768655
JCDBG01804JCDBG02218co-exp0.800243
JCDBG21805JCDBG06107co-exp0.802088
JCDBG21805JCDBG06821co-exp0.831466
JCDBG21805JCDBG03740co-exp0.751597
JCDBG21805JCDBG02116co-exp0.920242
JCDBG21805JCDBG02827co-exp0.934237
JCDBG21805JCDBG09535co-exp0.852691
JCDBG21805JCDBG21804co-exp0.913285
JCDBG21805JCDBG02218co-exp0.845673
JCDBG06107JCDBG06821co-exp0.742966
JCDBG06107JCDBG03740co-exp0.70222
JCDBG06107JCDBG02116co-exp0.786405
JCDBG06107JCDBG02827co-exp0.767084
JCDBG06107JCDBG09535co-exp0.789765
JCDBG06107JCDBG21804co-exp0.828394
JCDBG06107JCDBG02218co-exp0.732311
JCDBG06821JCDBG03740co-exp0.689961
JCDBG06821JCDBG02116co-exp0.861156
JCDBG06821JCDBG02827co-exp0.823903
JCDBG06821JCDBG09535co-exp0.832657
JCDBG06821JCDBG21804co-exp0.808403
JCDBG06821JCDBG02218co-exp0.75934
JCDBG03740JCDBG02116co-exp0.726194
JCDBG03740JCDBG02827co-exp0.790305
JCDBG03740JCDBG09535co-exp0.71751
JCDBG03740JCDBG21804co-exp0.746603
JCDBG03740JCDBG02218co-exp0.673508
JCDBG02116JCDBG02827co-exp0.946164
JCDBG02116JCDBG09535co-exp0.892557
JCDBG02116JCDBG21804co-exp0.914944
JCDBG02116JCDBG02218co-exp0.860131
JCDBG02827JCDBG09535co-exp0.843304
JCDBG02827JCDBG21804co-exp0.927159
JCDBG02827JCDBG02218co-exp0.867617
JCDBG09535JCDBG21804co-exp0.837524
JCDBG09535JCDBG02218co-exp0.784101
JCDBG21804JCDBG02218co-exp0.897162
PPI network
node1node2type
JCDBR00101
ID
JCDBR00101
Name
JCDBR00101
Type
Scaffold
NC_012224.1
Start
123144
End
123222
Strand
+
Exon
123144-123222
Sequence
CGCTATGGTGAAATCGGTAGACACGCTGCTCTTAGGAAGCAGTGCTAGAGCATCTCGGTTCGAGTCCGAGTAGCGGCAT
Product
tRNA-Leu
Source
RefSeq
Link: