Detail information of JCDBG00113

JCDBG00113
ID
JCDBG00113
Name
trnN-GUU
Type
tRNA
Scaffold
NC_012224.1
Start
139261
End
139332
Strand
+
Link
Genbank id:7636401
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
CCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACTGACTGGTCGTAGGTTCGAATCCTACTTGGGGAGA
Gene structure

JCDB Genes gff download

JCDBG00113 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00112
ID
JCDBR00112
Name
JCDBR00112
Type
Scaffold
NC_012224.1
Start
139261
End
139332
Strand
+
Exon
139261-139332
Sequence
CCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACTGACTGGTCGTAGGTTCGAATCCTACTTGGGGAGA
Product
tRNA-Asn
Source
RefSeq
Link: