Detail information of JCDBG00114

JCDBG00114
ID
JCDBG00114
Name
trnR-ACG
Type
tRNA
Scaffold
NC_012224.1
Start
139951
End
140024
Strand
-
Link
Genbank id:7636402
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGGGCCTGTAGCTCAGAGGATTAGAGCACGTGGCTACGAACCACGGTGTCGGGGGTTCGAATCCCTCCTCGCCC
Gene structure

JCDB Genes gff download

JCDBG00114 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00113
ID
JCDBR00113
Name
JCDBR00113
Type
Scaffold
NC_012224.1
Start
139951
End
140024
Strand
-
Exon
139951-140024
Sequence
GGGGCCTGTAGCTCAGAGGATTAGAGCACGTGGCTACGAACCACGGTGTCGGGGGTTCGAATCCCTCCTCGCCC
Product
tRNA-Arg
Source
RefSeq
Link: