Detail information of JCDBG00115

JCDBG00115
ID
JCDBG00115
Name
rrn5
Type
rRNA
Scaffold
NC_012224.1
Start
140264
End
140384
Strand
-
Link
Genbank id:7636403
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
ATATTCTGGTGTCCTAGGCGTAGAGGAACCACACCAATCCATCCCGAACTTGGTGGTTAAACTCTACTGCGGTGAAGATA CTGTAGGGGAGGTCCTGCGGAAAAATAGCTCGACGCCAGGA
Gene structure

JCDB Genes gff download

JCDBG00115 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG00115's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG00115JCDBG10335co-exp0.623803
JCDBG00115JCDBG18753co-exp0.618131
JCDBG10335JCDBG18753co-exp0.775969
PPI network
node1node2type
JCDBR00114
ID
JCDBR00114
Name
JCDBR00114
Type
Scaffold
NC_012224.1
Start
140264
End
140384
Strand
-
Exon
140264-140384
Sequence
ATATTCTGGTGTCCTAGGCGTAGAGGAACCACACCAATCCATCCCGAACTTGGTGGTTAAACTCTACTGCGGTGAAGATA CTGTAGGGGAGGTCCTGCGGAAAAATAGCTCGACGCCAGGA
Product
rrn5
Source
RefSeq
Link: