Detail information of JCDBG00116

JCDBG00116
ID
JCDBG00116
Name
rrn4.5
Type
rRNA
Scaffold
NC_012224.1
Start
140615
End
140717
Strand
-
Link
Genbank id:7636404
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
AGAAGGTCACGGCGAGACGAGCCGTTTATCATTACGATAGGTGTCAAGTGGAAGTGCAGTGATGTATGCAGCTGAGGCAT CCTAACAGACCGGTAGACTTGAA
Gene structure

JCDB Genes gff download

JCDBG00116 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00115
ID
JCDBR00115
Name
JCDBR00115
Type
Scaffold
NC_012224.1
Start
140615
End
140717
Strand
-
Exon
140615-140717
Sequence
AGAAGGTCACGGCGAGACGAGCCGTTTATCATTACGATAGGTGTCAAGTGGAAGTGCAGTGATGTATGCAGCTGAGGCAT CCTAACAGACCGGTAGACTTGAA
Product
rrn4.5
Source
RefSeq
Link: