Detail information of JCDBG00118

JCDBG00118
ID
JCDBG00118
Name
trnA-UGC
Type
tRNA
Scaffold
NC_012224.1
Start
143793
End
144663
Strand
-
Link
Genbank id:7636406
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
GGGGGATATAGCTCAGTTGGTAGAGCTCCGCTCTTGCAATTGGGTCGTTGCGATTACGGGTTGGATGTCTAATTGTCCAG GCGGTAATGATAGTATCTTGTACCTGAACCGGTGGCTCACTTTTTCTAAATAATGGGGAAGAGGACCGAAACATGCCACT GAAAGACTCTACTGAGACAAAGATGGGCTGTCAAGAACGTAGAGGAGGTAAGATGGGCAGTTGGTCAGATCTAGTATGGA TCGTACATGGACGATAGTTGGAGTCGGCGGCTCTCCTAGGGTTCCCTCATCTGGGATCCCTGGGGAAGAGGATCAAGTTG GCCCTTGCGAACAGCTTGATGCACTATCTCCCTTCAACCCTTTAGCGAAATGCGGCAAAAGGAAGGAAAATCCATGGACC GACCCCATCGTCTCCACCCCGTAGGAACTACGAGATCACCCCAAGGACGCCTTCGGCATCCAGGGGTCGCGGACCGACCA TAGAACCCTGTTCAATAAGTGGAACGCATTAGCTGTCCGCTCTCAGGTTGGGCAGTAAGGGTCGGAGAAGGGCAATCACT CATTCTTAAAATCAGCATTCTTAAGACCAAAGAGTGGGCGGAAAAAGGGGGGGCTCCCCGTTCCTAGTTTTCCTGTAGCT GGATCCTCCGGAACCACAAGAGTCCTTAGTTAGAATGGGATTCCAACTCAGCACCTTTTGAGATTTTGAGAAGAGTTGCT CTTTGGAGAGCACAGTACGATGAAAGTTGTAAGCTGTGTTCGGGGGGGAGTTATTGTCTATCGTTGGCCTCTATGGTAGA ATCAGTCGGGGGCCCGAGAGGCGGTGGTTTACCCTGTGGCGGATGTCAGCGGTTCGAGTCCGCTTATCTCC
Gene structure

JCDB Genes gff download

JCDBG00118 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00117
ID
JCDBR00117
Name
JCDBR00117
Type
Scaffold
NC_012224.1
Start
143793
End
144663
Strand
-
Exon
143793-143827,144626-144663
Sequence
GGGGGATATAGCTCAGTTGGTAGAGCTCCGCTCTTGCAATTGGGTCGTTGCGATTACGGGTTGGATGTCTAATTGTCCAG GCGGTAATGATAGTATCTTGTACCTGAACCGGTGGCTCACTTTTTCTAAATAATGGGGAAGAGGACCGAAACATGCCACT GAAAGACTCTACTGAGACAAAGATGGGCTGTCAAGAACGTAGAGGAGGTAAGATGGGCAGTTGGTCAGATCTAGTATGGA TCGTACATGGACGATAGTTGGAGTCGGCGGCTCTCCTAGGGTTCCCTCATCTGGGATCCCTGGGGAAGAGGATCAAGTTG GCCCTTGCGAACAGCTTGATGCACTATCTCCCTTCAACCCTTTAGCGAAATGCGGCAAAAGGAAGGAAAATCCATGGACC GACCCCATCGTCTCCACCCCGTAGGAACTACGAGATCACCCCAAGGACGCCTTCGGCATCCAGGGGTCGCGGACCGACCA TAGAACCCTGTTCAATAAGTGGAACGCATTAGCTGTCCGCTCTCAGGTTGGGCAGTAAGGGTCGGAGAAGGGCAATCACT CATTCTTAAAATCAGCATTCTTAAGACCAAAGAGTGGGCGGAAAAAGGGGGGGCTCCCCGTTCCTAGTTTTCCTGTAGCT GGATCCTCCGGAACCACAAGAGTCCTTAGTTAGAATGGGATTCCAACTCAGCACCTTTTGAGATTTTGAGAAGAGTTGCT CTTTGGAGAGCACAGTACGATGAAAGTTGTAAGCTGTGTTCGGGGGGGAGTTATTGTCTATCGTTGGCCTCTATGGTAGA ATCAGTCGGGGGCCCGAGAGGCGGTGGTTTACCCTGTGGCGGATGTCAGCGGTTCGAGTCCGCTTATCTCC
Product
tRNA-Ala
Source
RefSeq
Link: