Detail information of JCDBG00119

JCDBG00119
ID
JCDBG00119
Name
trnI-GAU
Type
tRNA
Scaffold
NC_012224.1
Start
144728
End
145753
Strand
-
Link
Genbank id:7636407
Molecular function
Cellular component
Biological process
KEGG
Source
RefSeq
TF
Description
Sequence
CGGGCTATTAGCTCAGTGGTAGAGCGCGCCCCTGATAATTGCGTCGTTGTGCCTGGGCTGTGAGGGCTCTCAGCCACATG GATAGTTCAATGTGCTCATCAGCGCCTGACCCTGAGATGTGGATCATCCAAGGCACATTAGCATGGCGTACTTCTCCTGT TCGAACCGGGGTTTGAAACCAAACTTCTCCTCAGGAGGATAGATGGGGCGATTCAGGTGAGATCCAATGTAGATCCAACT TTCTATTCACTCGTGGGATCCGGGCGGTCCGGGGGGGACCACCACGGCTCCTCTCTTCTCGAGAATCCATACATCCCTTA TCAATGTATGGACAGCTATCTCTCGAGCACAGGTTTAGGTTCGGCCTCAATGGGAAAATAAAATGGAGCACCTAACAACG TATCTTCACAGACCAAGAACTACGAGATCGCCCCTTTCATTCTGGGGCGACGGAGGGATCGTACCATTCGAGCCTTTTTT TTCATGCTTTTCCCGGAGGTCTGGAGAAAGCTGCAATCAATAGGATTTTCCTAACCCTCCCTTCCCGAAAGGCGAAAGGA AGGAGGTGAAATTCTTTTTCCTTTCCGCAGGGACCAGGAGATTGGATCTAGCCGTAAGAAGAATGCTTGGCTGATAAATA ACTCACTTCTTGGTCTTCGACCCCCTCAGTCACTACGAACGCCCCCGGTCAGTGCAATGGGATGTGTCTATTTATCTATC TCTTGACTCGAAATGGGAGTAGGTTTGAAAAAGGATCTTAGAGTGTCTAAGGTGGGGCCAGGAGGGTCTCTTAACGCCTT CTTTTTCTTCTCATCGGAGTTATTTCAAAAAGACTTGCCATGGTAAGGAAGAAGGGGAGAACAAGCACACTTGGAGAGCG CAGTACAACGAAGAATTGTATGCTGCGTTCGGGAAGGATGAATCGCTCCCGAAAAGGAATCTATTGATTCTCTCCCAATT AGTTGGACCGTAGGTGCGATGATTTACTTCACGGGCGAGGTCTCTGGTTCAAGTCCAGGATGGCCC
Gene structure

JCDB Genes gff download

JCDBG00119 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBR00118
ID
JCDBR00118
Name
JCDBR00118
Type
Scaffold
NC_012224.1
Start
144728
End
145753
Strand
-
Exon
144728-144762,145717-145753
Sequence
CGGGCTATTAGCTCAGTGGTAGAGCGCGCCCCTGATAATTGCGTCGTTGTGCCTGGGCTGTGAGGGCTCTCAGCCACATG GATAGTTCAATGTGCTCATCAGCGCCTGACCCTGAGATGTGGATCATCCAAGGCACATTAGCATGGCGTACTTCTCCTGT TCGAACCGGGGTTTGAAACCAAACTTCTCCTCAGGAGGATAGATGGGGCGATTCAGGTGAGATCCAATGTAGATCCAACT TTCTATTCACTCGTGGGATCCGGGCGGTCCGGGGGGGACCACCACGGCTCCTCTCTTCTCGAGAATCCATACATCCCTTA TCAATGTATGGACAGCTATCTCTCGAGCACAGGTTTAGGTTCGGCCTCAATGGGAAAATAAAATGGAGCACCTAACAACG TATCTTCACAGACCAAGAACTACGAGATCGCCCCTTTCATTCTGGGGCGACGGAGGGATCGTACCATTCGAGCCTTTTTT TTCATGCTTTTCCCGGAGGTCTGGAGAAAGCTGCAATCAATAGGATTTTCCTAACCCTCCCTTCCCGAAAGGCGAAAGGA AGGAGGTGAAATTCTTTTTCCTTTCCGCAGGGACCAGGAGATTGGATCTAGCCGTAAGAAGAATGCTTGGCTGATAAATA ACTCACTTCTTGGTCTTCGACCCCCTCAGTCACTACGAACGCCCCCGGTCAGTGCAATGGGATGTGTCTATTTATCTATC TCTTGACTCGAAATGGGAGTAGGTTTGAAAAAGGATCTTAGAGTGTCTAAGGTGGGGCCAGGAGGGTCTCTTAACGCCTT CTTTTTCTTCTCATCGGAGTTATTTCAAAAAGACTTGCCATGGTAAGGAAGAAGGGGAGAACAAGCACACTTGGAGAGCG CAGTACAACGAAGAATTGTATGCTGCGTTCGGGAAGGATGAATCGCTCCCGAAAAGGAATCTATTGATTCTCTCCCAATT AGTTGGACCGTAGGTGCGATGATTTACTTCACGGGCGAGGTCTCTGGTTCAAGTCCAGGATGGCCC
Product
tRNA-Ile
Source
RefSeq
Link: