Detail information of JCDBG25296

JCDBG25296
ID
JCDBG25296
Name
LOC105650731
Type
pseudogene
Scaffold
NW_012130064.1
Start
926981
End
928919
Strand
-
Link
Genbank id:105650731
Molecular function
Cellular component
Biological process
KEGG
Source
Gnomon
TF
Description
LEAF
Sequence
AATGTCCGGGACTGATTCTAAATTTGCGTTTAAAATTGCCTTAGGTATATGATGCTCCAATTGATATCTTATTTTGTtcc ttattttcttatatgataaaaattgcTTGAACATCAATCTGTCATTGAATGATAAATCGTTCCCCATCTTCTACATCCAG GTTCTGGGCCAGCTATTGCAACTGTAGCATAATATGTGTAATCTTGTTCATCTATCTACGTCacaagaaaaaacaatttg gtccatcttcttctgtttctttACGGGAACATGTTTCTTCAgaggaagatattgagaaAGGGCTTGGATTCTTTGCCCCT ATCTTCCCGTACAGTGAACTAGAAGCTGCAACCAATAATTTTGACGCTGCTAGagaaattgaaacaatttGGTCCATCTT CTTCTGTTTGTTTACGGGAACAGGTTTCTTCAgaggaagatattgagaaAGGGCGTGGATTCTTTGCCCCGATCTTCCCG TACAGTGAACGAGAAGCTGCAACCAATAATTTTGACGCTGCTAGAGAAATTGGAGGTGGTGGCTTTTGCACAGTATACTA TGGTAAAAGAAGAGACTGTCATTAAATATCTAAGTgaattatgttaaataaaacttttatgtGTATCTTTTCTCTTTAGG CATGCTCCGGGATGGGCGAGAAATTGCAGTTAAGCGCTTGTATGGTAACAATTACAGGAGAGTTAGGCAGTTTATAAATG AACTTGAGGTCCTATCTCGCTTTCGCCAGACACATCTTGTCTCATTATATGGCTCCACCGCTCACCGTAGTAGGATACTG TTACTAGTGTATGAGTATGTTCCTAATGGTACAGTTTTTGGTCATCTTCATGGTGAAAGGGCAAAGTCTGGTGGGCTTCC ATGGTCTACTCGAATGAAAATTGCAGTAGAGTCAGCTTGTGCATTAGCATATCTCCATGCTTCTGATATCATACACCGTG ATGTGAAAACCAAAAACATTCTCCTTGAATACGATTTTCATGTTAAAGTTGCAGATTTTGGATTGTCTCGCCTCTTTCCA CTGGATGTTACTCATGTTTCAGCTGCTCCACAAGGAACTCCTGGTTATGTTGATCCTGAGTACCATGAGTTCCACCGGTT TACTGATAAGAGTGATGTTTATAGTTTTGGAGTGGTCTTGATTGAGCTTATATCATCACTGCCTGCTGTTGAAATCGCTG GGAATTGACACGAGATAAAATTGTCTAGTTTCGCCATCAATAAGATACAAAGTTGTGCACTAGATGAACTTGTTGATTGA AGCCTTGGATTTGGATCAGATTATGCAATAACAAGAATGACAAATGCAGTGGCAGAGTTAGCATTTGATTGTCTACAAAG CACGAAGGATTTAAGACCGTCTATGGAAGAAGTGTTGGAAACTGAGATTCAAAGTAAGGATTACAATATTGATAAGGCAG AGGAAATTGATATTCCATCAGATGATGTTGGATTGCTAAAAGGTGGTTCTTTTGCTGACATTTCCTGATGCTGTTATAAT GAAATGGGTTAGCTCCTCTACAGTGCCTAAGTTTTGCTTCTTTCGAGTACATTAAACTGAAGCAGCAGAATAGTTACTTG ATGAACTTTGAGGAGAAACTTTAAAAGGCATCGGAGGAATTTCCAGTGAATCACTGGAAACTTGTAACATAAACAAAACC TGACTCATTGAAGGTCTTTGTGAAGGATTGGTCTGTACGCACCATAGGCCTACTATGGTCATTTTTCTTGCaatttcatc ttcttctttggtCCTAACAGAACATAGCCCCAGATCATTTTCGAGTTGCAGACGAGTGTAGATCCAATGTGGGAAATAAA TCTTCCTTCTATTTTCCGCCATAACATTTGCATTCTTCCTTCCACTTACCATTTCTAAAATCATCACTCCATAGTTATAC ACATCGGATTTATGCGAAA
Gene structure

JCDB Genes gff download

JCDBG25296 's gene expression heatmap with it's positive (above) and negative (bellow) co-expressed neighbours

Mouse click the small gray square will display sample information.

JCDBG25296's gene network (protein-protein interaction & gene co-expression among this gene and its Top10 neighbors)   

Node color:
Pumpkin: this gene;
Macaroni And Cheese : co-expression gene;
Forest Green :protein-interacting gene ;
Edge color:
Pelorous: co-expression;
Turquoise Blue HueBlue : protein protein interaction;

co-expression network
node1node2typescc
JCDBG25296JCDBG14617co-exp0.792916
JCDBG25296JCDBG22755co-exp0.774622
JCDBG25296JCDBG07425co-exp0.763877
JCDBG25296JCDBG06899co-exp0.760613
JCDBG25296JCDBG04197co-exp0.757502
JCDBG25296JCDBG08670co-exp0.752372
JCDBG25296JCDBG23683co-exp0.748065
JCDBG25296JCDBG21488co-exp0.743221
JCDBG25296JCDBG24193co-exp0.740233
JCDBG25296JCDBG07163co-exp0.739925
JCDBG14617JCDBG22755co-exp0.83195
JCDBG14617JCDBG07425co-exp0.804263
JCDBG14617JCDBG06899co-exp0.882688
JCDBG14617JCDBG04197co-exp0.89189
JCDBG14617JCDBG08670co-exp0.840026
JCDBG14617JCDBG23683co-exp0.643949
JCDBG14617JCDBG21488co-exp0.789378
JCDBG14617JCDBG24193co-exp0.844767
JCDBG14617JCDBG07163co-exp0.785113
JCDBG22755JCDBG07425co-exp0.837872
JCDBG22755JCDBG06899co-exp0.806555
JCDBG22755JCDBG04197co-exp0.865676
JCDBG22755JCDBG08670co-exp0.715038
JCDBG22755JCDBG23683co-exp0.695975
JCDBG22755JCDBG21488co-exp0.755016
JCDBG22755JCDBG24193co-exp0.855525
JCDBG22755JCDBG07163co-exp0.761848
JCDBG07425JCDBG06899co-exp0.802681
JCDBG07425JCDBG04197co-exp0.786427
JCDBG07425JCDBG08670co-exp0.691961
JCDBG07425JCDBG23683co-exp0.69627
JCDBG07425JCDBG21488co-exp0.761157
JCDBG07425JCDBG24193co-exp0.718909
JCDBG07425JCDBG07163co-exp0.772874
JCDBG06899JCDBG04197co-exp0.836856
JCDBG06899JCDBG08670co-exp0.834073
JCDBG06899JCDBG23683co-exp0.682623
JCDBG06899JCDBG21488co-exp0.854823
JCDBG06899JCDBG24193co-exp0.800438
JCDBG06899JCDBG07163co-exp0.817386
JCDBG04197JCDBG08670co-exp0.771362
JCDBG04197JCDBG23683co-exp0.655673
JCDBG04197JCDBG21488co-exp0.747824
JCDBG04197JCDBG24193co-exp0.882512
JCDBG04197JCDBG07163co-exp0.743447
JCDBG08670JCDBG23683co-exp0.657232
JCDBG08670JCDBG21488co-exp0.793428
JCDBG08670JCDBG24193co-exp0.766298
JCDBG08670JCDBG07163co-exp0.754657
JCDBG23683JCDBG21488co-exp0.678929
JCDBG23683JCDBG24193co-exp0.615986
JCDBG21488JCDBG24193co-exp0.707477
JCDBG21488JCDBG07163co-exp0.782709
JCDBG24193JCDBG07163co-exp0.767327
PPI network
node1node2type
JCDBR33784
ID
JCDBR33784
Name
LOC105650731
Type
pseudogene
Scaffold
NW_012130064.1
Start
926981
End
928919
Strand
-
Exon
Sequence
Product
Source
Gnomon
Link: